Mutagenetix > Incidental Mutation

Incidental Mutation 'R9527:Col9a2'

719305

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9527 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 121042331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000030372

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	A	G	2: 128,044,364	D453G	probably benign	Het
Aqr	A	C	2: 114,101,556	S1443R	probably benign	Het
Atr	T	C	9: 95,885,376	M1162T	probably damaging	Het
Bicdl1	T	A	5: 115,673,129	N241I	possibly damaging	Het
Catip	A	G	1: 74,362,478	N38S	probably benign	Het
Ccdc130	A	T	8: 84,263,023	C56S	probably damaging	Het
Cct6b	A	G	11: 82,739,621		probably null	Het
Clspn	A	T	4: 126,559,999	R72*	probably null	Het
Cntln	A	G	4: 84,973,883	Q335R	probably damaging	Het
Dip2c	A	G	13: 9,494,839	N55D	unknown	Het
Dnajc5b	A	T	3: 19,579,084	D157V	probably damaging	Het
Exoc6	T	G	19: 37,570,539	D86E	probably benign	Het
Fam204a	A	T	19: 60,220,560	H87Q	probably damaging	Het
Fam208b	A	T	13: 3,585,191	S539T	possibly damaging	Het
Fer1l4	A	G	2: 156,029,697	W1388R	probably damaging	Het
Hcn2	A	T	10: 79,734,872	I642F	probably benign	Het
Igsf9	C	A	1: 172,495,677	L653M	probably damaging	Het
Imp4	A	G	1: 34,442,910	E38G	probably benign	Het
Kirrel	C	A	3: 87,089,605	E297*	probably null	Het
Krt82	G	A	15: 101,546,123	T222I	probably benign	Het
Lysmd1	T	C	3: 95,134,845	L10P	probably benign	Het
Mcmbp	A	G	7: 128,703,518	S509P	probably damaging	Het
Mms19	A	T	19: 41,964,391	I93N	possibly damaging	Het
Mtmr7	A	G	8: 40,558,304	F402L	possibly damaging	Het
Myo1h	C	T	5: 114,315,037	R49C		Het
Scd3	T	C	19: 44,238,377	Y217H	probably benign	Het
Snx17	T	C	5: 31,196,482	Y205H	probably damaging	Het
Spag17	T	A	3: 100,063,461	D1320E	probably damaging	Het
Xirp1	C	A	9: 120,018,492	V442L	probably damaging	Het
Xrcc5	G	A	1: 72,329,932	R315H	probably damaging	Het
Zc3hav1	C	A	6: 38,353,978	C82F	probably damaging	Het
Zfp787	A	G	7: 6,133,028	F75L	probably damaging	Het
Zswim3	C	T	2: 164,820,365	T255I	probably damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTTTTGAGCAAAGGGAGC -3'
(R):5'- AGAGCCGACATCTTGCTACC -3'

Sequencing Primer
(F):5'- CAGGCTTGTCCACACAAT -3'
(R):5'- CAGGCTCTCCTTTGGAT -3'

Posted On

2022-07-18