Incidental Mutation 'R9527:Col9a2'
ID 719305
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 120899528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030372
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A G 2: 127,886,284 (GRCm39) D453G probably benign Het
Aqr A C 2: 113,932,037 (GRCm39) S1443R probably benign Het
Atr T C 9: 95,767,429 (GRCm39) M1162T probably damaging Het
Bicdl1 T A 5: 115,811,188 (GRCm39) N241I possibly damaging Het
Catip A G 1: 74,401,637 (GRCm39) N38S probably benign Het
Cct6b A G 11: 82,630,447 (GRCm39) probably null Het
Clspn A T 4: 126,453,792 (GRCm39) R72* probably null Het
Cntln A G 4: 84,892,120 (GRCm39) Q335R probably damaging Het
Dip2c A G 13: 9,544,875 (GRCm39) N55D unknown Het
Dnajc5b A T 3: 19,633,248 (GRCm39) D157V probably damaging Het
Exoc6 T G 19: 37,558,987 (GRCm39) D86E probably benign Het
Fam204a A T 19: 60,208,992 (GRCm39) H87Q probably damaging Het
Fer1l4 A G 2: 155,871,617 (GRCm39) W1388R probably damaging Het
Hcn2 A T 10: 79,570,706 (GRCm39) I642F probably benign Het
Igsf9 C A 1: 172,323,244 (GRCm39) L653M probably damaging Het
Imp4 A G 1: 34,481,991 (GRCm39) E38G probably benign Het
Kirrel1 C A 3: 86,996,912 (GRCm39) E297* probably null Het
Krt82 G A 15: 101,454,558 (GRCm39) T222I probably benign Het
Lysmd1 T C 3: 95,042,156 (GRCm39) L10P probably benign Het
Mcmbp A G 7: 128,305,242 (GRCm39) S509P probably damaging Het
Mms19 A T 19: 41,952,830 (GRCm39) I93N possibly damaging Het
Mtmr7 A G 8: 41,011,345 (GRCm39) F402L possibly damaging Het
Myo1h C T 5: 114,453,098 (GRCm39) R49C Het
Scd3 T C 19: 44,226,816 (GRCm39) Y217H probably benign Het
Snx17 T C 5: 31,353,826 (GRCm39) Y205H probably damaging Het
Spag17 T A 3: 99,970,777 (GRCm39) D1320E probably damaging Het
Tasor2 A T 13: 3,635,191 (GRCm39) S539T possibly damaging Het
Xirp1 C A 9: 119,847,558 (GRCm39) V442L probably damaging Het
Xrcc5 G A 1: 72,369,091 (GRCm39) R315H probably damaging Het
Yju2b A T 8: 84,989,652 (GRCm39) C56S probably damaging Het
Zc3hav1 C A 6: 38,330,913 (GRCm39) C82F probably damaging Het
Zfp787 A G 7: 6,136,027 (GRCm39) F75L probably damaging Het
Zswim3 C T 2: 164,662,285 (GRCm39) T255I probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTTTGAGCAAAGGGAGC -3'
(R):5'- AGAGCCGACATCTTGCTACC -3'

Sequencing Primer
(F):5'- CAGGCTTGTCCACACAAT -3'
(R):5'- CAGGCTCTCCTTTGGAT -3'
Posted On 2022-07-18