Incidental Mutation 'R9527:Bicdl1'
ID 719309
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene Name BICD family like cargo adaptor 1
Synonyms 2210403N09Rik, BICDR-1, Ccdc64
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R9527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 115786234-115869680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115811188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 241 (N241I)
Ref Sequence ENSEMBL: ENSMUSP00000053547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000141950] [ENSMUST00000148276]
AlphaFold A0JNT9
Predicted Effect possibly damaging
Transcript: ENSMUST00000055408
AA Change: N241I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: N241I

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141950
AA Change: N177I

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119015
Gene: ENSMUSG00000041609
AA Change: N177I

DomainStartEndE-ValueType
Pfam:HAP1_N 35 99 4.5e-11 PFAM
coiled coil region 192 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148276
SMART Domains Protein: ENSMUSP00000119664
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 1 110 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
coiled coil region 178 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A G 2: 127,886,284 (GRCm39) D453G probably benign Het
Aqr A C 2: 113,932,037 (GRCm39) S1443R probably benign Het
Atr T C 9: 95,767,429 (GRCm39) M1162T probably damaging Het
Catip A G 1: 74,401,637 (GRCm39) N38S probably benign Het
Cct6b A G 11: 82,630,447 (GRCm39) probably null Het
Clspn A T 4: 126,453,792 (GRCm39) R72* probably null Het
Cntln A G 4: 84,892,120 (GRCm39) Q335R probably damaging Het
Col9a2 T C 4: 120,899,528 (GRCm39) probably null Het
Dip2c A G 13: 9,544,875 (GRCm39) N55D unknown Het
Dnajc5b A T 3: 19,633,248 (GRCm39) D157V probably damaging Het
Exoc6 T G 19: 37,558,987 (GRCm39) D86E probably benign Het
Fam204a A T 19: 60,208,992 (GRCm39) H87Q probably damaging Het
Fer1l4 A G 2: 155,871,617 (GRCm39) W1388R probably damaging Het
Hcn2 A T 10: 79,570,706 (GRCm39) I642F probably benign Het
Igsf9 C A 1: 172,323,244 (GRCm39) L653M probably damaging Het
Imp4 A G 1: 34,481,991 (GRCm39) E38G probably benign Het
Kirrel1 C A 3: 86,996,912 (GRCm39) E297* probably null Het
Krt82 G A 15: 101,454,558 (GRCm39) T222I probably benign Het
Lysmd1 T C 3: 95,042,156 (GRCm39) L10P probably benign Het
Mcmbp A G 7: 128,305,242 (GRCm39) S509P probably damaging Het
Mms19 A T 19: 41,952,830 (GRCm39) I93N possibly damaging Het
Mtmr7 A G 8: 41,011,345 (GRCm39) F402L possibly damaging Het
Myo1h C T 5: 114,453,098 (GRCm39) R49C Het
Scd3 T C 19: 44,226,816 (GRCm39) Y217H probably benign Het
Snx17 T C 5: 31,353,826 (GRCm39) Y205H probably damaging Het
Spag17 T A 3: 99,970,777 (GRCm39) D1320E probably damaging Het
Tasor2 A T 13: 3,635,191 (GRCm39) S539T possibly damaging Het
Xirp1 C A 9: 119,847,558 (GRCm39) V442L probably damaging Het
Xrcc5 G A 1: 72,369,091 (GRCm39) R315H probably damaging Het
Yju2b A T 8: 84,989,652 (GRCm39) C56S probably damaging Het
Zc3hav1 C A 6: 38,330,913 (GRCm39) C82F probably damaging Het
Zfp787 A G 7: 6,136,027 (GRCm39) F75L probably damaging Het
Zswim3 C T 2: 164,662,285 (GRCm39) T255I probably damaging Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115,808,215 (GRCm39) nonsense probably null
IGL01902:Bicdl1 APN 5 115,789,933 (GRCm39) missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115,801,944 (GRCm39) missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115,811,217 (GRCm39) missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115,801,881 (GRCm39) missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115,869,219 (GRCm39) missense probably damaging 1.00
bargain UTSW 5 115,808,212 (GRCm39) critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115,810,202 (GRCm39) critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115,869,351 (GRCm39) missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115,799,587 (GRCm39) splice site probably benign
R1581:Bicdl1 UTSW 5 115,789,326 (GRCm39) unclassified probably benign
R1589:Bicdl1 UTSW 5 115,789,325 (GRCm39) unclassified probably benign
R1669:Bicdl1 UTSW 5 115,794,075 (GRCm39) missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115,793,987 (GRCm39) missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115,862,638 (GRCm39) missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115,862,638 (GRCm39) missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115,862,638 (GRCm39) missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115,799,537 (GRCm39) missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115,808,212 (GRCm39) critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115,810,202 (GRCm39) critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115,808,229 (GRCm39) missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115,789,916 (GRCm39) missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115,808,340 (GRCm39) missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115,801,845 (GRCm39) nonsense probably null
R7781:Bicdl1 UTSW 5 115,799,546 (GRCm39) missense probably damaging 1.00
R8236:Bicdl1 UTSW 5 115,787,618 (GRCm39) missense probably benign 0.28
R8816:Bicdl1 UTSW 5 115,862,804 (GRCm39) missense probably damaging 1.00
R9320:Bicdl1 UTSW 5 115,862,769 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCCACTTAAGTTCTCACAGG -3'
(R):5'- ACCTAGGCTGTCATTTATGGTG -3'

Sequencing Primer
(F):5'- CTCACAGGAACGTCTCTTTAGATG -3'
(R):5'- AACACTCACCCTAAAGTTCTGTGGG -3'
Posted On 2022-07-18