Incidental Mutation 'R9527:Bicdl1'
ID 719309
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene Name BICD family like cargo adaptor 1
Synonyms 2210403N09Rik, Ccdc64, BICDR-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R9527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 115648175-115731621 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115673129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 241 (N241I)
Ref Sequence ENSEMBL: ENSMUSP00000053547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000141950] [ENSMUST00000148276]
AlphaFold A0JNT9
Predicted Effect possibly damaging
Transcript: ENSMUST00000055408
AA Change: N241I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: N241I

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141950
AA Change: N177I

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119015
Gene: ENSMUSG00000041609
AA Change: N177I

DomainStartEndE-ValueType
Pfam:HAP1_N 35 99 4.5e-11 PFAM
coiled coil region 192 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148276
SMART Domains Protein: ENSMUSP00000119664
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 1 110 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
coiled coil region 178 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A G 2: 128,044,364 D453G probably benign Het
Aqr A C 2: 114,101,556 S1443R probably benign Het
Atr T C 9: 95,885,376 M1162T probably damaging Het
Catip A G 1: 74,362,478 N38S probably benign Het
Ccdc130 A T 8: 84,263,023 C56S probably damaging Het
Cct6b A G 11: 82,739,621 probably null Het
Clspn A T 4: 126,559,999 R72* probably null Het
Cntln A G 4: 84,973,883 Q335R probably damaging Het
Col9a2 T C 4: 121,042,331 probably null Het
Dip2c A G 13: 9,494,839 N55D unknown Het
Dnajc5b A T 3: 19,579,084 D157V probably damaging Het
Exoc6 T G 19: 37,570,539 D86E probably benign Het
Fam204a A T 19: 60,220,560 H87Q probably damaging Het
Fam208b A T 13: 3,585,191 S539T possibly damaging Het
Fer1l4 A G 2: 156,029,697 W1388R probably damaging Het
Hcn2 A T 10: 79,734,872 I642F probably benign Het
Igsf9 C A 1: 172,495,677 L653M probably damaging Het
Imp4 A G 1: 34,442,910 E38G probably benign Het
Kirrel C A 3: 87,089,605 E297* probably null Het
Krt82 G A 15: 101,546,123 T222I probably benign Het
Lysmd1 T C 3: 95,134,845 L10P probably benign Het
Mcmbp A G 7: 128,703,518 S509P probably damaging Het
Mms19 A T 19: 41,964,391 I93N possibly damaging Het
Mtmr7 A G 8: 40,558,304 F402L possibly damaging Het
Myo1h C T 5: 114,315,037 R49C Het
Scd3 T C 19: 44,238,377 Y217H probably benign Het
Snx17 T C 5: 31,196,482 Y205H probably damaging Het
Spag17 T A 3: 100,063,461 D1320E probably damaging Het
Xirp1 C A 9: 120,018,492 V442L probably damaging Het
Xrcc5 G A 1: 72,329,932 R315H probably damaging Het
Zc3hav1 C A 6: 38,353,978 C82F probably damaging Het
Zfp787 A G 7: 6,133,028 F75L probably damaging Het
Zswim3 C T 2: 164,820,365 T255I probably damaging Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115731292 missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115651857 missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
R7781:Bicdl1 UTSW 5 115661487 missense probably damaging 1.00
R8816:Bicdl1 UTSW 5 115724745 missense probably damaging 1.00
R9320:Bicdl1 UTSW 5 115724710 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCCACTTAAGTTCTCACAGG -3'
(R):5'- ACCTAGGCTGTCATTTATGGTG -3'

Sequencing Primer
(F):5'- CTCACAGGAACGTCTCTTTAGATG -3'
(R):5'- AACACTCACCCTAAAGTTCTGTGGG -3'
Posted On 2022-07-18