Incidental Mutation 'R9527:Cct6b'
ID 719318
Institutional Source Beutler Lab
Gene Symbol Cct6b
Ensembl Gene ENSMUSG00000020698
Gene Name chaperonin containing Tcp1, subunit 6b (zeta)
Synonyms CCTzeta-2, Cctz-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock # R9527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 82719250-82764321 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 82739621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021040] [ENSMUST00000100722]
AlphaFold Q61390
Predicted Effect probably null
Transcript: ENSMUST00000021040
SMART Domains Protein: ENSMUSP00000021040
Gene: ENSMUSG00000020698

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 30 526 1.1e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100722
SMART Domains Protein: ENSMUSP00000098288
Gene: ENSMUSG00000020698

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 4 486 9.7e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin-containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A G 2: 128,044,364 D453G probably benign Het
Aqr A C 2: 114,101,556 S1443R probably benign Het
Atr T C 9: 95,885,376 M1162T probably damaging Het
Bicdl1 T A 5: 115,673,129 N241I possibly damaging Het
Catip A G 1: 74,362,478 N38S probably benign Het
Ccdc130 A T 8: 84,263,023 C56S probably damaging Het
Clspn A T 4: 126,559,999 R72* probably null Het
Cntln A G 4: 84,973,883 Q335R probably damaging Het
Col9a2 T C 4: 121,042,331 probably null Het
Dip2c A G 13: 9,494,839 N55D unknown Het
Dnajc5b A T 3: 19,579,084 D157V probably damaging Het
Exoc6 T G 19: 37,570,539 D86E probably benign Het
Fam204a A T 19: 60,220,560 H87Q probably damaging Het
Fam208b A T 13: 3,585,191 S539T possibly damaging Het
Fer1l4 A G 2: 156,029,697 W1388R probably damaging Het
Hcn2 A T 10: 79,734,872 I642F probably benign Het
Igsf9 C A 1: 172,495,677 L653M probably damaging Het
Imp4 A G 1: 34,442,910 E38G probably benign Het
Kirrel C A 3: 87,089,605 E297* probably null Het
Krt82 G A 15: 101,546,123 T222I probably benign Het
Lysmd1 T C 3: 95,134,845 L10P probably benign Het
Mcmbp A G 7: 128,703,518 S509P probably damaging Het
Mms19 A T 19: 41,964,391 I93N possibly damaging Het
Mtmr7 A G 8: 40,558,304 F402L possibly damaging Het
Myo1h C T 5: 114,315,037 R49C Het
Scd3 T C 19: 44,238,377 Y217H probably benign Het
Snx17 T C 5: 31,196,482 Y205H probably damaging Het
Spag17 T A 3: 100,063,461 D1320E probably damaging Het
Xirp1 C A 9: 120,018,492 V442L probably damaging Het
Xrcc5 G A 1: 72,329,932 R315H probably damaging Het
Zc3hav1 C A 6: 38,353,978 C82F probably damaging Het
Zfp787 A G 7: 6,133,028 F75L probably damaging Het
Zswim3 C T 2: 164,820,365 T255I probably damaging Het
Other mutations in Cct6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Cct6b APN 11 82741391 missense probably damaging 1.00
IGL02606:Cct6b APN 11 82736445 missense probably damaging 1.00
IGL02707:Cct6b APN 11 82754954 splice site probably benign
IGL03081:Cct6b APN 11 82764169 nonsense probably null
R0032:Cct6b UTSW 11 82753643 missense possibly damaging 0.87
R0395:Cct6b UTSW 11 82739680 missense probably benign
R0556:Cct6b UTSW 11 82719444 splice site probably benign
R0631:Cct6b UTSW 11 82737088 splice site probably null
R1456:Cct6b UTSW 11 82753620 splice site probably benign
R3713:Cct6b UTSW 11 82760357 missense probably damaging 1.00
R4791:Cct6b UTSW 11 82742004 splice site probably null
R5154:Cct6b UTSW 11 82739695 missense probably damaging 1.00
R5256:Cct6b UTSW 11 82764220 missense probably damaging 0.98
R5338:Cct6b UTSW 11 82762189 missense possibly damaging 0.94
R5455:Cct6b UTSW 11 82755117 missense probably benign 0.04
R5560:Cct6b UTSW 11 82741413 missense probably damaging 1.00
R5616:Cct6b UTSW 11 82741349 missense probably damaging 1.00
R5644:Cct6b UTSW 11 82722455 missense probably benign 0.02
R6862:Cct6b UTSW 11 82719959 missense probably damaging 1.00
R7960:Cct6b UTSW 11 82741395 missense possibly damaging 0.94
R8240:Cct6b UTSW 11 82723824 missense probably damaging 1.00
R8785:Cct6b UTSW 11 82741331 missense probably damaging 1.00
R8943:Cct6b UTSW 11 82764133 utr 5 prime probably benign
R9674:Cct6b UTSW 11 82755012 missense probably damaging 1.00
X0060:Cct6b UTSW 11 82741310 missense probably benign 0.00
Z1176:Cct6b UTSW 11 82723939 missense probably damaging 1.00
Z1176:Cct6b UTSW 11 82764065 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTACCAGGTATATACATGAGATGAC -3'
(R):5'- AATGCTTGAGGAATAGTGGTCTGC -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- CTGCATGTTTTGAGGTCAGGGATAG -3'
Posted On 2022-07-18