Incidental Mutation 'R9528:Adgrd1'
ID 719337
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9528 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129179676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 703 (Y703C)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably benign
Transcript: ENSMUST00000056617
AA Change: Y703C

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: Y703C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156437
AA Change: Y671C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: Y671C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A T 8: 106,504,497 D105V unknown Het
Abi2 T C 1: 60,434,294 S57P probably damaging Het
Acap2 C A 16: 31,111,090 K358N possibly damaging Het
Alpi A G 1: 87,099,050 probably null Het
Bpifb9b A G 2: 154,311,377 E121G probably benign Het
Btnl1 T A 17: 34,384,378 F338I possibly damaging Het
Clptm1l G A 13: 73,612,431 S311N possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col6a3 T A 1: 90,804,067 K1488M probably damaging Het
Crot A T 5: 8,993,575 Y16N possibly damaging Het
Dnajc13 T C 9: 104,237,705 S56G probably benign Het
Dpep3 C A 8: 105,977,619 A230S probably benign Het
Gabrr2 T C 4: 33,081,483 I173T probably benign Het
Klhl5 T C 5: 65,156,243 probably null Het
Lekr1 T C 3: 65,684,187 F115S unknown Het
Lipc A T 9: 70,934,559 M1K probably null Het
Lrfn5 T A 12: 61,839,622 N65K probably benign Het
Mmp17 G C 5: 129,606,328 E509D probably benign Het
Myo1f T C 17: 33,578,182 probably null Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr63 T A 17: 33,269,471 V249E probably damaging Het
Olfr850 A G 9: 19,478,148 F34S probably damaging Het
Olfr98 T A 17: 37,263,196 H156L probably benign Het
Pclo G A 5: 14,677,677 R2183Q unknown Het
Plec T A 15: 76,176,833 H2968L possibly damaging Het
Ppp2r1a A G 17: 20,955,891 E125G probably benign Het
Prkcd T C 14: 30,601,811 D458G probably damaging Het
Ptch1 A C 13: 63,513,801 N1174K probably benign Het
Sarnp A G 10: 128,872,457 R180G probably damaging Het
Secisbp2 A G 13: 51,656,943 K214E possibly damaging Het
Sorl1 C A 9: 42,022,335 probably null Het
Speg T A 1: 75,387,803 I276N possibly damaging Het
Txnrd3 A G 6: 89,672,972 Y518C probably damaging Het
Unc13c T A 9: 73,930,678 I964F possibly damaging Het
Wars2 A G 3: 99,204,606 H140R possibly damaging Het
Zfp148 T A 16: 33,496,290 I444N probably benign Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGAGAAACTGAGCCTTGCC -3'
(R):5'- AGAACCCATTCCATTCCATCTG -3'

Sequencing Primer
(F):5'- TCCCCAGGAATAAAATGAGGTCCTG -3'
(R):5'- TGCCCCATCCCTACCCG -3'
Posted On 2022-07-18