Mutagenetix > Incidental Mutation

Incidental Mutation 'R9528:Prkcd'

719354

Institutional Source

Beutler Lab

Gene Symbol

Prkcd

Ensembl Gene

ENSMUSG00000021948

Gene Name

protein kinase C, delta

Synonyms

Pkcd, D14Ertd420e, PKC[d], PKCdelta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R9528 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30595354-30626210 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30601811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 458 (D458G)

Ref Sequence

ENSEMBL: ENSMUSP00000022521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]

AlphaFold

P28867

PDB Structure

PROTEIN KINASE C DELTA CYS2 DOMAIN [X-RAY DIFFRACTION]
PROTEIN KINASE C DELTA CYS2 DOMAIN COMPLEXED WITH PHORBOL-13-ACETATE [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022521
AA Change: D458G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: D458G

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112202
AA Change: D343G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948
AA Change: D343G

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112203
AA Change: D317G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948
AA Change: D317G

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112206
AA Change: D343G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948
AA Change: D343G

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART
S_TK_X	513	576	8.92e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112207
AA Change: D317G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948
AA Change: D317G

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART
S_TK_X	487	550	8.92e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112210
AA Change: D432G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: D432G

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	347	601	1.17e-97	SMART
S_TK_X	602	665	8.92e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112211
AA Change: D458G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: D458G

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030452D12Rik	A	T	8: 106,504,497	D105V	unknown	Het
Abi2	T	C	1: 60,434,294	S57P	probably damaging	Het
Acap2	C	A	16: 31,111,090	K358N	possibly damaging	Het
Adgrd1	A	G	5: 129,179,676	Y703C	probably benign	Het
Alpi	A	G	1: 87,099,050		probably null	Het
Bpifb9b	A	G	2: 154,311,377	E121G	probably benign	Het
Btnl1	T	A	17: 34,384,378	F338I	possibly damaging	Het
Clptm1l	G	A	13: 73,612,431	S311N	possibly damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col6a3	T	A	1: 90,804,067	K1488M	probably damaging	Het
Crot	A	T	5: 8,993,575	Y16N	possibly damaging	Het
Dnajc13	T	C	9: 104,237,705	S56G	probably benign	Het
Dpep3	C	A	8: 105,977,619	A230S	probably benign	Het
Gabrr2	T	C	4: 33,081,483	I173T	probably benign	Het
Klhl5	T	C	5: 65,156,243		probably null	Het
Lekr1	T	C	3: 65,684,187	F115S	unknown	Het
Lipc	A	T	9: 70,934,559	M1K	probably null	Het
Lrfn5	T	A	12: 61,839,622	N65K	probably benign	Het
Mmp17	G	C	5: 129,606,328	E509D	probably benign	Het
Myo1f	T	C	17: 33,578,182		probably null	Het
Olfr304	T	A	7: 86,385,851	R270*	probably null	Het
Olfr63	T	A	17: 33,269,471	V249E	probably damaging	Het
Olfr850	A	G	9: 19,478,148	F34S	probably damaging	Het
Olfr98	T	A	17: 37,263,196	H156L	probably benign	Het
Pclo	G	A	5: 14,677,677	R2183Q	unknown	Het
Plec	T	A	15: 76,176,833	H2968L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,955,891	E125G	probably benign	Het
Ptch1	A	C	13: 63,513,801	N1174K	probably benign	Het
Sarnp	A	G	10: 128,872,457	R180G	probably damaging	Het
Secisbp2	A	G	13: 51,656,943	K214E	possibly damaging	Het
Sorl1	C	A	9: 42,022,335		probably null	Het
Speg	T	A	1: 75,387,803	I276N	possibly damaging	Het
Txnrd3	A	G	6: 89,672,972	Y518C	probably damaging	Het
Unc13c	T	A	9: 73,930,678	I964F	possibly damaging	Het
Wars2	A	G	3: 99,204,606	H140R	possibly damaging	Het
Zfp148	T	A	16: 33,496,290	I444N	probably benign	Het

Other mutations in Prkcd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Prkcd	APN	14	30602422	splice site	probably benign
IGL00715:Prkcd	APN	14	30596003	missense	probably damaging	1.00
IGL01914:Prkcd	APN	14	30607426	missense	possibly damaging	0.49
IGL02177:Prkcd	APN	14	30605887	missense	probably damaging	1.00
IGL02547:Prkcd	APN	14	30599469	missense	probably damaging	1.00
IGL02681:Prkcd	APN	14	30601233	critical splice acceptor site	probably null
Rigged	UTSW	14	30610301	start codon destroyed	probably null	0.99
rigged2	UTSW	14	30599743	missense	probably damaging	1.00
IGL03014:Prkcd	UTSW	14	30607337	missense	probably damaging	1.00
R0240:Prkcd	UTSW	14	30602088	missense	probably damaging	0.97
R0240:Prkcd	UTSW	14	30602088	missense	probably damaging	0.97
R1385:Prkcd	UTSW	14	30607405	missense	probably damaging	1.00
R1567:Prkcd	UTSW	14	30607448	missense	probably benign	0.35
R2114:Prkcd	UTSW	14	30605851	missense	probably damaging	1.00
R2983:Prkcd	UTSW	14	30599478	missense	probably damaging	1.00
R3716:Prkcd	UTSW	14	30599712	missense	probably benign	0.00
R4162:Prkcd	UTSW	14	30601197	missense	probably damaging	0.98
R4164:Prkcd	UTSW	14	30601197	missense	probably damaging	0.98
R4180:Prkcd	UTSW	14	30610304	utr 5 prime	probably benign
R4637:Prkcd	UTSW	14	30598765	missense	probably benign	0.00
R4750:Prkcd	UTSW	14	30610301	start codon destroyed	probably null	0.99
R4756:Prkcd	UTSW	14	30599666	missense	probably benign	0.00
R4849:Prkcd	UTSW	14	30599743	missense	probably damaging	1.00
R4850:Prkcd	UTSW	14	30599743	missense	probably damaging	1.00
R4893:Prkcd	UTSW	14	30599425	missense	probably damaging	1.00
R4914:Prkcd	UTSW	14	30605438	critical splice donor site	probably null
R4925:Prkcd	UTSW	14	30607613	missense	probably damaging	0.98
R5644:Prkcd	UTSW	14	30607413	missense	probably benign	0.06
R5832:Prkcd	UTSW	14	30605821	missense	probably damaging	0.99
R5910:Prkcd	UTSW	14	30595981	missense	probably benign	0.01
R6049:Prkcd	UTSW	14	30607297	missense	possibly damaging	0.95
R6322:Prkcd	UTSW	14	30599663	missense	probably damaging	1.00
R7177:Prkcd	UTSW	14	30599707	missense	probably damaging	1.00
R7358:Prkcd	UTSW	14	30605836	missense	probably benign
R7494:Prkcd	UTSW	14	30609193	missense	probably benign	0.00
R7554:Prkcd	UTSW	14	30609263	missense	probably damaging	0.96
R7778:Prkcd	UTSW	14	30605815	critical splice donor site	probably null
R7810:Prkcd	UTSW	14	30598450	splice site	probably null
R8020:Prkcd	UTSW	14	30609244	missense	possibly damaging	0.58
R8145:Prkcd	UTSW	14	30602062	missense	probably benign	0.03
R8417:Prkcd	UTSW	14	30609251	missense	probably benign	0.36
R9009:Prkcd	UTSW	14	30607340	missense	probably damaging	0.99
R9246:Prkcd	UTSW	14	30605475	missense	probably damaging	1.00
R9748:Prkcd	UTSW	14	30598843	missense	possibly damaging	0.87
R9783:Prkcd	UTSW	14	30599487	missense	probably damaging	0.99
Z1176:Prkcd	UTSW	14	30610249	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CCAGTGCTAGCTCTATCCTGAC -3'
(R):5'- ACCAAGGTTCCTGACTTTCC -3'

Sequencing Primer
(F):5'- AGTGCTAGCTCTATCCTGACTCAAG -3'
(R):5'- GGCTGTGTCTGTTCTAGTCACAC -3'

Posted On

2022-07-18