Incidental Mutation 'R9528:Btnl1'
ID 719361
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9528 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34603352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 338 (F338I)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect possibly damaging
Transcript: ENSMUST00000080254
AA Change: F338I

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: F338I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A T 8: 107,231,129 (GRCm39) D105V unknown Het
Abi2 T C 1: 60,473,453 (GRCm39) S57P probably damaging Het
Acap2 C A 16: 30,929,908 (GRCm39) K358N possibly damaging Het
Adgrd1 A G 5: 129,256,740 (GRCm39) Y703C probably benign Het
Alpi A G 1: 87,026,772 (GRCm39) probably null Het
Bpifb9b A G 2: 154,153,297 (GRCm39) E121G probably benign Het
Clptm1l G A 13: 73,760,550 (GRCm39) S311N possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Col6a3 T A 1: 90,731,789 (GRCm39) K1488M probably damaging Het
Crot A T 5: 9,043,575 (GRCm39) Y16N possibly damaging Het
Dnajc13 T C 9: 104,114,904 (GRCm39) S56G probably benign Het
Dpep3 C A 8: 106,704,251 (GRCm39) A230S probably benign Het
Gabrr2 T C 4: 33,081,483 (GRCm39) I173T probably benign Het
Klhl5 T C 5: 65,313,586 (GRCm39) probably null Het
Lekr1 T C 3: 65,591,608 (GRCm39) F115S unknown Het
Lipc A T 9: 70,841,841 (GRCm39) M1K probably null Het
Lrfn5 T A 12: 61,886,408 (GRCm39) N65K probably benign Het
Mmp17 G C 5: 129,683,392 (GRCm39) E509D probably benign Het
Myo1f T C 17: 33,797,156 (GRCm39) probably null Het
Or10h28 T A 17: 33,488,445 (GRCm39) V249E probably damaging Het
Or14a258 T A 7: 86,035,059 (GRCm39) R270* probably null Het
Or1o3 T A 17: 37,574,087 (GRCm39) H156L probably benign Het
Or7g32 A G 9: 19,389,444 (GRCm39) F34S probably damaging Het
Pclo G A 5: 14,727,691 (GRCm39) R2183Q unknown Het
Plec T A 15: 76,061,033 (GRCm39) H2968L possibly damaging Het
Ppp2r1a A G 17: 21,176,153 (GRCm39) E125G probably benign Het
Prkcd T C 14: 30,323,768 (GRCm39) D458G probably damaging Het
Ptch1 A C 13: 63,661,615 (GRCm39) N1174K probably benign Het
Sarnp A G 10: 128,708,326 (GRCm39) R180G probably damaging Het
Secisbp2 A G 13: 51,810,979 (GRCm39) K214E possibly damaging Het
Sorl1 C A 9: 41,933,631 (GRCm39) probably null Het
Speg T A 1: 75,364,447 (GRCm39) I276N possibly damaging Het
Txnrd3 A G 6: 89,649,954 (GRCm39) Y518C probably damaging Het
Unc13c T A 9: 73,837,960 (GRCm39) I964F possibly damaging Het
Wars2 A G 3: 99,111,922 (GRCm39) H140R possibly damaging Het
Zfp148 T A 16: 33,316,660 (GRCm39) I444N probably benign Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTCCTGAGAGCACAGAG -3'
(R):5'- AACAGTGTGGCCAAGCTTG -3'

Sequencing Primer
(F):5'- TTCCTGAGAGCACAGAGAGCAC -3'
(R):5'- CCCCATTCAGCTTGAACAAGTGTATG -3'
Posted On 2022-07-18