Mutagenetix > Incidental Mutation

Incidental Mutation 'R9529:Rp1'

719363

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R9529 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4185896-4479508 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4416447 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1555 (H1555L)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably benign
Transcript: ENSMUST00000027032
AA Change: H1555L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: H1555L

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	C	5: 113,331,682 (GRCm39)	L844R	possibly damaging	Het
Aadacl4fm2	A	G	4: 144,282,082 (GRCm39)	Y237H	probably benign	Het
Abca8a	A	T	11: 109,947,167 (GRCm39)	Y1036*	probably null	Het
Abcg3	T	C	5: 105,121,973 (GRCm39)	T135A	probably damaging	Het
Arhgef28	G	A	13: 98,213,773 (GRCm39)	A30V	probably damaging	Het
Cald1	T	A	6: 34,662,947 (GRCm39)	D3E	probably damaging	Het
Ccdc89	T	A	7: 90,076,573 (GRCm39)	L261Q	probably damaging	Het
Ceacam1	T	C	7: 25,171,231 (GRCm39)	D411G	possibly damaging	Het
Chil4	T	A	3: 106,118,656 (GRCm39)	N87Y	probably damaging	Het
Ciita	T	A	16: 10,328,640 (GRCm39)	L308Q	probably benign	Het
Clptm1	T	C	7: 19,371,600 (GRCm39)	I278V	probably benign	Het
Col5a3	A	T	9: 20,685,308 (GRCm39)		probably null	Het
Ddost	T	A	4: 138,038,780 (GRCm39)	D336E	probably benign	Het
Dnah7a	T	C	1: 53,561,495 (GRCm39)	Y2054C	probably damaging	Het
Erc2	T	A	14: 28,197,723 (GRCm39)	L1000H	unknown	Het
Fhip2b	T	C	14: 70,822,579 (GRCm39)	E714G	probably damaging	Het
Gdpd4	T	C	7: 97,610,793 (GRCm39)	V71A	possibly damaging	Het
Hmcn1	A	G	1: 150,545,175 (GRCm39)	Y2811H	probably damaging	Het
Hmox2	C	T	16: 4,582,818 (GRCm39)	Q184*	probably null	Het
Igkv9-124	G	T	6: 67,919,280 (GRCm39)	T44N	probably benign	Het
Kmt2d	G	A	15: 98,737,649 (GRCm39)	T5149I	unknown	Het
Lamb2	T	A	9: 108,363,477 (GRCm39)	D885E	probably benign	Het
Macf1	A	G	4: 123,407,680 (GRCm39)	S220P	probably damaging	Het
Muc2	A	T	7: 141,287,453 (GRCm39)	T211S	possibly damaging	Het
Mup13	A	T	4: 61,184,117 (GRCm39)	C15S	possibly damaging	Het
Myh3	T	C	11: 66,979,556 (GRCm39)		probably null	Het
Nek10	A	G	14: 14,850,833 (GRCm38)	I293V	probably benign	Het
Or10d3	G	A	9: 39,461,723 (GRCm39)	T148I	probably benign	Het
Or2a52	T	A	6: 43,144,432 (GRCm39)	S147T	possibly damaging	Het
Or6c68	A	G	10: 129,158,205 (GRCm39)	T238A	probably damaging	Het
Pdss2	G	A	10: 43,269,990 (GRCm39)	V278I	probably benign	Het
Prex1	T	C	2: 166,431,518 (GRCm39)	K748R	probably damaging	Het
Ptprb	A	G	10: 116,174,519 (GRCm39)		probably null	Het
Ranbp17	G	A	11: 33,424,826 (GRCm39)	S510L	unknown	Het
Rsph6a	A	G	7: 18,799,535 (GRCm39)	K389E	probably benign	Het
Ryk	T	C	9: 102,746,518 (GRCm39)	V151A	probably benign	Het
Ryr3	T	A	2: 112,465,660 (GRCm39)	N4838I	possibly damaging	Het
Sbno1	G	A	5: 124,517,413 (GRCm39)	R1233*	probably null	Het
Scn2a	A	T	2: 65,594,932 (GRCm39)	K1927M	probably damaging	Het
Sec22c	A	T	9: 121,513,860 (GRCm39)	I259N	probably damaging	Het
Slc6a15	A	T	10: 103,240,583 (GRCm39)	D402V	probably benign	Het
Stk38	G	A	17: 29,207,210 (GRCm39)	T111I	probably damaging	Het
Tmem237	G	A	1: 59,147,215 (GRCm39)	T306I	probably damaging	Het
Tmprss11a	T	C	5: 86,576,501 (GRCm39)	K117E	probably benign	Het
Tmprss9	A	T	10: 80,730,640 (GRCm39)	D722V	probably damaging	Het
Trpc1	T	C	9: 95,592,250 (GRCm39)	Y575C	probably damaging	Het
Ube2d2b	A	G	5: 107,978,438 (GRCm39)	M30V	probably benign	Het
Usp36	A	T	11: 118,159,461 (GRCm39)	L661*	probably null	Het
Vmn2r13	G	T	5: 109,304,064 (GRCm39)	T789N	probably damaging	Het
Vmn2r5	T	C	3: 64,400,018 (GRCm39)	T550A	probably benign	Het
Xirp2	T	C	2: 67,355,540 (GRCm39)	S3434P	possibly damaging	Het
Zfp106	A	G	2: 120,351,007 (GRCm39)	V1571A	probably damaging	Het
Zfp438	A	G	18: 5,213,501 (GRCm39)	S486P	possibly damaging	Het
Zfp616	A	G	11: 73,975,660 (GRCm39)	H643R	probably damaging	Het
Zfp616	A	G	11: 73,976,596 (GRCm39)	K955R	possibly damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4,416,969 (GRCm39)	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4,415,626 (GRCm39)	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4,422,435 (GRCm39)	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4,415,461 (GRCm39)	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4,419,168 (GRCm39)	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4,415,941 (GRCm39)	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4,418,730 (GRCm39)	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4,422,745 (GRCm39)	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4,415,533 (GRCm39)	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4,417,608 (GRCm39)	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4,419,003 (GRCm39)	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4,422,613 (GRCm39)	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4,419,271 (GRCm39)	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4,418,673 (GRCm39)	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4,419,936 (GRCm39)	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4,416,375 (GRCm39)	nonsense	probably null
IGL03288:Rp1	APN	1	4,419,747 (GRCm39)	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4,420,264 (GRCm39)	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4,415,040 (GRCm39)	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4,414,851 (GRCm39)	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4,414,983 (GRCm39)	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4,417,941 (GRCm39)	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4,416,970 (GRCm39)	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4,415,088 (GRCm39)	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4,416,721 (GRCm39)	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4,415,575 (GRCm39)	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4,422,513 (GRCm39)	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4,415,185 (GRCm39)	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4,416,159 (GRCm39)	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4,418,193 (GRCm39)	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4,417,619 (GRCm39)	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4,418,760 (GRCm39)	missense	probably benign	0.20
R1509:Rp1	UTSW	1	4,417,917 (GRCm39)	missense	probably damaging	0.98
R1538:Rp1	UTSW	1	4,415,899 (GRCm39)	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4,419,424 (GRCm39)	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4,420,086 (GRCm39)	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4,415,392 (GRCm39)	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4,419,312 (GRCm39)	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4,419,055 (GRCm39)	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4,417,455 (GRCm39)	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4,418,943 (GRCm39)	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4,422,894 (GRCm39)	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4,418,575 (GRCm39)	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4,418,250 (GRCm39)	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4,416,182 (GRCm39)	nonsense	probably null
R2316:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4,418,236 (GRCm39)	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4,419,988 (GRCm39)	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4,419,931 (GRCm39)	missense	probably benign
R3929:Rp1	UTSW	1	4,422,868 (GRCm39)	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4,415,623 (GRCm39)	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4,418,147 (GRCm39)	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4,414,886 (GRCm39)	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4,416,101 (GRCm39)	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4,419,451 (GRCm39)	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4,418,898 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,540 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,539 (GRCm39)	missense	probably damaging	0.99
R5159:Rp1	UTSW	1	4,416,426 (GRCm39)	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4,418,256 (GRCm39)	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4,419,583 (GRCm39)	splice site	probably null
R5352:Rp1	UTSW	1	4,417,321 (GRCm39)	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4,420,113 (GRCm39)	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4,416,616 (GRCm39)	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4,416,055 (GRCm39)	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4,415,460 (GRCm39)	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4,418,685 (GRCm39)	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4,218,926 (GRCm39)	missense	unknown
R6004:Rp1	UTSW	1	4,267,808 (GRCm39)	missense	unknown
R6018:Rp1	UTSW	1	4,423,059 (GRCm39)	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4,415,602 (GRCm39)	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4,419,534 (GRCm39)	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4,420,092 (GRCm39)	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4,417,477 (GRCm39)	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4,112,212 (GRCm39)	missense	unknown
R6405:Rp1	UTSW	1	4,415,994 (GRCm39)	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4,296,840 (GRCm39)	missense	unknown
R6466:Rp1	UTSW	1	4,418,109 (GRCm39)	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4,381,503 (GRCm39)	intron	probably benign
R6547:Rp1	UTSW	1	4,240,528 (GRCm39)	missense	unknown
R6604:Rp1	UTSW	1	4,089,351 (GRCm39)	missense	unknown
R6700:Rp1	UTSW	1	4,420,119 (GRCm39)	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4,212,887 (GRCm39)	missense	unknown
R6831:Rp1	UTSW	1	4,420,087 (GRCm39)	splice site	probably null
R6918:Rp1	UTSW	1	4,069,831 (GRCm39)	missense	unknown
R6973:Rp1	UTSW	1	4,422,217 (GRCm39)	nonsense	probably null
R6981:Rp1	UTSW	1	4,415,878 (GRCm39)	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4,112,291 (GRCm39)	missense	unknown
R7078:Rp1	UTSW	1	4,277,014 (GRCm39)	missense	unknown
R7112:Rp1	UTSW	1	4,419,241 (GRCm39)	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4,418,391 (GRCm39)	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4,420,140 (GRCm39)	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4,417,513 (GRCm39)	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4,298,824 (GRCm39)	missense	unknown
R7367:Rp1	UTSW	1	4,418,221 (GRCm39)	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4,415,704 (GRCm39)	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4,381,501 (GRCm39)	missense	unknown
R7569:Rp1	UTSW	1	4,355,063 (GRCm39)	missense	unknown
R7642:Rp1	UTSW	1	4,218,054 (GRCm39)	missense	unknown
R7693:Rp1	UTSW	1	4,417,626 (GRCm39)	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4,240,457 (GRCm39)	missense	unknown
R7759:Rp1	UTSW	1	4,415,107 (GRCm39)	missense	probably benign
R7784:Rp1	UTSW	1	4,212,881 (GRCm39)	missense	unknown
R7816:Rp1	UTSW	1	4,417,926 (GRCm39)	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4,417,924 (GRCm39)	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4,315,318 (GRCm39)	missense	unknown
R8281:Rp1	UTSW	1	4,418,139 (GRCm39)	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4,416,220 (GRCm39)	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4,417,312 (GRCm39)	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4,418,572 (GRCm39)	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4,416,813 (GRCm39)	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4,419,784 (GRCm39)	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4,419,007 (GRCm39)	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4,416,628 (GRCm39)	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4,095,091 (GRCm39)	missense	unknown
R8859:Rp1	UTSW	1	4,420,183 (GRCm39)	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4,419,817 (GRCm39)	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4,419,650 (GRCm39)	intron	probably benign
R8979:Rp1	UTSW	1	4,218,937 (GRCm39)	missense	unknown
R9126:Rp1	UTSW	1	4,417,136 (GRCm39)	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4,234,161 (GRCm39)	missense	unknown
R9160:Rp1	UTSW	1	4,416,720 (GRCm39)	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4,315,266 (GRCm39)	missense	unknown
R9263:Rp1	UTSW	1	4,419,160 (GRCm39)	missense	probably benign	0.02
R9263:Rp1	UTSW	1	4,418,675 (GRCm39)	missense	probably benign	0.25
R9302:Rp1	UTSW	1	4,416,789 (GRCm39)	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4,418,488 (GRCm39)	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4,313,841 (GRCm39)	missense	unknown
R9474:Rp1	UTSW	1	4,162,838 (GRCm39)	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4,417,545 (GRCm39)	missense	probably benign	0.06
R9572:Rp1	UTSW	1	4,418,662 (GRCm39)	missense	probably benign
R9673:Rp1	UTSW	1	4,337,792 (GRCm39)	missense	unknown
R9709:Rp1	UTSW	1	4,112,255 (GRCm39)	missense	unknown
R9716:Rp1	UTSW	1	4,212,833 (GRCm39)	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4,414,917 (GRCm39)	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4,419,783 (GRCm39)	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4,417,918 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACTTGAGATTTGTGTATAGACCCATGG -3'
(R):5'- TACTGCCATTCTGGAGACAACC -3'

Sequencing Primer
(F):5'- CCCATGGAAAAATGGTGGTTTG -3'
(R):5'- CATTCTGGAGACAACCGCTAGG -3'

Posted On

2022-07-18