Mutagenetix > Incidental Mutation

Incidental Mutation 'R9529:Muc2'

719392

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R9529 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141287453 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 211 (T211S)

Ref Sequence

ENSEMBL: ENSMUSP00000140855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366
AA Change: T210S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515
AA Change: T210S

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185823
AA Change: T211S

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: T211S

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

probably benign
Transcript: ENSMUST00000191587

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	C	5: 113,331,682 (GRCm39)	L844R	possibly damaging	Het
Aadacl4fm2	A	G	4: 144,282,082 (GRCm39)	Y237H	probably benign	Het
Abca8a	A	T	11: 109,947,167 (GRCm39)	Y1036*	probably null	Het
Abcg3	T	C	5: 105,121,973 (GRCm39)	T135A	probably damaging	Het
Arhgef28	G	A	13: 98,213,773 (GRCm39)	A30V	probably damaging	Het
Cald1	T	A	6: 34,662,947 (GRCm39)	D3E	probably damaging	Het
Ccdc89	T	A	7: 90,076,573 (GRCm39)	L261Q	probably damaging	Het
Ceacam1	T	C	7: 25,171,231 (GRCm39)	D411G	possibly damaging	Het
Chil4	T	A	3: 106,118,656 (GRCm39)	N87Y	probably damaging	Het
Ciita	T	A	16: 10,328,640 (GRCm39)	L308Q	probably benign	Het
Clptm1	T	C	7: 19,371,600 (GRCm39)	I278V	probably benign	Het
Col5a3	A	T	9: 20,685,308 (GRCm39)		probably null	Het
Ddost	T	A	4: 138,038,780 (GRCm39)	D336E	probably benign	Het
Dnah7a	T	C	1: 53,561,495 (GRCm39)	Y2054C	probably damaging	Het
Erc2	T	A	14: 28,197,723 (GRCm39)	L1000H	unknown	Het
Fhip2b	T	C	14: 70,822,579 (GRCm39)	E714G	probably damaging	Het
Gdpd4	T	C	7: 97,610,793 (GRCm39)	V71A	possibly damaging	Het
Hmcn1	A	G	1: 150,545,175 (GRCm39)	Y2811H	probably damaging	Het
Hmox2	C	T	16: 4,582,818 (GRCm39)	Q184*	probably null	Het
Igkv9-124	G	T	6: 67,919,280 (GRCm39)	T44N	probably benign	Het
Kmt2d	G	A	15: 98,737,649 (GRCm39)	T5149I	unknown	Het
Lamb2	T	A	9: 108,363,477 (GRCm39)	D885E	probably benign	Het
Macf1	A	G	4: 123,407,680 (GRCm39)	S220P	probably damaging	Het
Mup13	A	T	4: 61,184,117 (GRCm39)	C15S	possibly damaging	Het
Myh3	T	C	11: 66,979,556 (GRCm39)		probably null	Het
Nek10	A	G	14: 14,850,833 (GRCm38)	I293V	probably benign	Het
Or10d3	G	A	9: 39,461,723 (GRCm39)	T148I	probably benign	Het
Or2a52	T	A	6: 43,144,432 (GRCm39)	S147T	possibly damaging	Het
Or6c68	A	G	10: 129,158,205 (GRCm39)	T238A	probably damaging	Het
Pdss2	G	A	10: 43,269,990 (GRCm39)	V278I	probably benign	Het
Prex1	T	C	2: 166,431,518 (GRCm39)	K748R	probably damaging	Het
Ptprb	A	G	10: 116,174,519 (GRCm39)		probably null	Het
Ranbp17	G	A	11: 33,424,826 (GRCm39)	S510L	unknown	Het
Rp1	T	A	1: 4,416,447 (GRCm39)	H1555L	probably benign	Het
Rsph6a	A	G	7: 18,799,535 (GRCm39)	K389E	probably benign	Het
Ryk	T	C	9: 102,746,518 (GRCm39)	V151A	probably benign	Het
Ryr3	T	A	2: 112,465,660 (GRCm39)	N4838I	possibly damaging	Het
Sbno1	G	A	5: 124,517,413 (GRCm39)	R1233*	probably null	Het
Scn2a	A	T	2: 65,594,932 (GRCm39)	K1927M	probably damaging	Het
Sec22c	A	T	9: 121,513,860 (GRCm39)	I259N	probably damaging	Het
Slc6a15	A	T	10: 103,240,583 (GRCm39)	D402V	probably benign	Het
Stk38	G	A	17: 29,207,210 (GRCm39)	T111I	probably damaging	Het
Tmem237	G	A	1: 59,147,215 (GRCm39)	T306I	probably damaging	Het
Tmprss11a	T	C	5: 86,576,501 (GRCm39)	K117E	probably benign	Het
Tmprss9	A	T	10: 80,730,640 (GRCm39)	D722V	probably damaging	Het
Trpc1	T	C	9: 95,592,250 (GRCm39)	Y575C	probably damaging	Het
Ube2d2b	A	G	5: 107,978,438 (GRCm39)	M30V	probably benign	Het
Usp36	A	T	11: 118,159,461 (GRCm39)	L661*	probably null	Het
Vmn2r13	G	T	5: 109,304,064 (GRCm39)	T789N	probably damaging	Het
Vmn2r5	T	C	3: 64,400,018 (GRCm39)	T550A	probably benign	Het
Xirp2	T	C	2: 67,355,540 (GRCm39)	S3434P	possibly damaging	Het
Zfp106	A	G	2: 120,351,007 (GRCm39)	V1571A	probably damaging	Het
Zfp438	A	G	18: 5,213,501 (GRCm39)	S486P	possibly damaging	Het
Zfp616	A	G	11: 73,975,660 (GRCm39)	H643R	probably damaging	Het
Zfp616	A	G	11: 73,976,596 (GRCm39)	K955R	possibly damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TGAGACTCGCTTTGGTAGGC -3'
(R):5'- ATGAATCGTGTTCCCTCAGCTAAG -3'

Sequencing Primer
(F):5'- AGGCACGGATTGGTCCTG -3'
(R):5'- AGCTAAGATTCTCAACCCTTGGG -3'

Posted On

2022-07-18