Mutagenetix > Incidental Mutation

Incidental Mutation 'R9529:Slc6a15'

719401

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9529 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103404722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 402 (D402V)

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204
AA Change: D402V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: D402V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636
AA Change: D402V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: D402V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	C	5: 113,183,816	L844R	possibly damaging	Het
Abca8a	A	T	11: 110,056,341	Y1036*	probably null	Het
Abcg3	T	C	5: 104,974,107	T135A	probably damaging	Het
Arhgef28	G	A	13: 98,077,265	A30V	probably damaging	Het
Cald1	T	A	6: 34,686,012	D3E	probably damaging	Het
Ccdc89	T	A	7: 90,427,365	L261Q	probably damaging	Het
Ceacam1	T	C	7: 25,471,806	D411G	possibly damaging	Het
Chil4	T	A	3: 106,211,340	N87Y	probably damaging	Het
Ciita	T	A	16: 10,510,776	L308Q	probably benign	Het
Clptm1	T	C	7: 19,637,675	I278V	probably benign	Het
Col5a3	A	T	9: 20,774,012		probably null	Het
Ddost	T	A	4: 138,311,469	D336E	probably benign	Het
Dnah7a	T	C	1: 53,522,336	Y2054C	probably damaging	Het
Erc2	T	A	14: 28,475,766	L1000H	unknown	Het
Fam160b2	T	C	14: 70,585,139	E714G	probably damaging	Het
Gdpd4	T	C	7: 97,961,586	V71A	possibly damaging	Het
Gm13124	A	G	4: 144,555,512	Y237H	probably benign	Het
Hmcn1	A	G	1: 150,669,424	Y2811H	probably damaging	Het
Hmox2	C	T	16: 4,764,954	Q184*	probably null	Het
Igkv9-124	G	T	6: 67,942,296	T44N	probably benign	Het
Kmt2d	G	A	15: 98,839,768	T5149I	unknown	Het
Lamb2	T	A	9: 108,486,278	D885E	probably benign	Het
Macf1	A	G	4: 123,513,887	S220P	probably damaging	Het
Muc2	A	T	7: 141,700,884	T211S	possibly damaging	Het
Mup13	A	T	4: 61,228,118	C15S	possibly damaging	Het
Myh3	T	C	11: 67,088,730		probably null	Het
Nek10	A	G	14: 14,850,833	I293V	probably benign	Het
Olfr437	T	A	6: 43,167,498	S147T	possibly damaging	Het
Olfr780	A	G	10: 129,322,336	T238A	probably damaging	Het
Olfr958	G	A	9: 39,550,427	T148I	probably benign	Het
Pdss2	G	A	10: 43,393,994	V278I	probably benign	Het
Prex1	T	C	2: 166,589,598	K748R	probably damaging	Het
Ptprb	A	G	10: 116,338,614		probably null	Het
Ranbp17	G	A	11: 33,474,826	S510L	unknown	Het
Rp1	T	A	1: 4,346,224	H1555L	probably benign	Het
Rsph6a	A	G	7: 19,065,610	K389E	probably benign	Het
Ryk	T	C	9: 102,869,319	V151A	probably benign	Het
Ryr3	T	A	2: 112,635,315	N4838I	possibly damaging	Het
Sbno1	G	A	5: 124,379,350	R1233*	probably null	Het
Scn2a	A	T	2: 65,764,588	K1927M	probably damaging	Het
Sec22c	A	T	9: 121,684,794	I259N	probably damaging	Het
Stk38	G	A	17: 28,988,236	T111I	probably damaging	Het
Tmem237	G	A	1: 59,108,056	T306I	probably damaging	Het
Tmprss11a	T	C	5: 86,428,642	K117E	probably benign	Het
Tmprss9	A	T	10: 80,894,806	D722V	probably damaging	Het
Trpc1	T	C	9: 95,710,197	Y575C	probably damaging	Het
Ube2d2b	A	G	5: 107,830,572	M30V	probably benign	Het
Usp36	A	T	11: 118,268,635	L661*	probably null	Het
Vmn2r13	G	T	5: 109,156,198	T789N	probably damaging	Het
Vmn2r5	T	C	3: 64,492,597	T550A	probably benign	Het
Xirp2	T	C	2: 67,525,196	S3434P	possibly damaging	Het
Zfp106	A	G	2: 120,520,526	V1571A	probably damaging	Het
Zfp438	A	G	18: 5,213,501	S486P	possibly damaging	Het
Zfp616	A	G	11: 74,084,834	H643R	probably damaging	Het
Zfp616	A	G	11: 74,085,770	K955R	possibly damaging	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCTGGGGTTCAAAGCC -3'
(R):5'- ATCCCCTTTCCTGAAGAAGGC -3'

Sequencing Primer
(F):5'- GGGTTCAAAGCCAATATCGTAAATG -3'
(R):5'- TCCTCAATTTGACAGGCG -3'

Posted On

2022-07-18