Incidental Mutation 'R9529:Slc6a15'
ID 719401
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9529 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103240583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 402 (D402V)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably benign
Transcript: ENSMUST00000074204
AA Change: D402V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: D402V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179636
AA Change: D402V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: D402V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A C 5: 113,331,682 (GRCm39) L844R possibly damaging Het
Aadacl4fm2 A G 4: 144,282,082 (GRCm39) Y237H probably benign Het
Abca8a A T 11: 109,947,167 (GRCm39) Y1036* probably null Het
Abcg3 T C 5: 105,121,973 (GRCm39) T135A probably damaging Het
Arhgef28 G A 13: 98,213,773 (GRCm39) A30V probably damaging Het
Cald1 T A 6: 34,662,947 (GRCm39) D3E probably damaging Het
Ccdc89 T A 7: 90,076,573 (GRCm39) L261Q probably damaging Het
Ceacam1 T C 7: 25,171,231 (GRCm39) D411G possibly damaging Het
Chil4 T A 3: 106,118,656 (GRCm39) N87Y probably damaging Het
Ciita T A 16: 10,328,640 (GRCm39) L308Q probably benign Het
Clptm1 T C 7: 19,371,600 (GRCm39) I278V probably benign Het
Col5a3 A T 9: 20,685,308 (GRCm39) probably null Het
Ddost T A 4: 138,038,780 (GRCm39) D336E probably benign Het
Dnah7a T C 1: 53,561,495 (GRCm39) Y2054C probably damaging Het
Erc2 T A 14: 28,197,723 (GRCm39) L1000H unknown Het
Fhip2b T C 14: 70,822,579 (GRCm39) E714G probably damaging Het
Gdpd4 T C 7: 97,610,793 (GRCm39) V71A possibly damaging Het
Hmcn1 A G 1: 150,545,175 (GRCm39) Y2811H probably damaging Het
Hmox2 C T 16: 4,582,818 (GRCm39) Q184* probably null Het
Igkv9-124 G T 6: 67,919,280 (GRCm39) T44N probably benign Het
Kmt2d G A 15: 98,737,649 (GRCm39) T5149I unknown Het
Lamb2 T A 9: 108,363,477 (GRCm39) D885E probably benign Het
Macf1 A G 4: 123,407,680 (GRCm39) S220P probably damaging Het
Muc2 A T 7: 141,287,453 (GRCm39) T211S possibly damaging Het
Mup13 A T 4: 61,184,117 (GRCm39) C15S possibly damaging Het
Myh3 T C 11: 66,979,556 (GRCm39) probably null Het
Nek10 A G 14: 14,850,833 (GRCm38) I293V probably benign Het
Or10d3 G A 9: 39,461,723 (GRCm39) T148I probably benign Het
Or2a52 T A 6: 43,144,432 (GRCm39) S147T possibly damaging Het
Or6c68 A G 10: 129,158,205 (GRCm39) T238A probably damaging Het
Pdss2 G A 10: 43,269,990 (GRCm39) V278I probably benign Het
Prex1 T C 2: 166,431,518 (GRCm39) K748R probably damaging Het
Ptprb A G 10: 116,174,519 (GRCm39) probably null Het
Ranbp17 G A 11: 33,424,826 (GRCm39) S510L unknown Het
Rp1 T A 1: 4,416,447 (GRCm39) H1555L probably benign Het
Rsph6a A G 7: 18,799,535 (GRCm39) K389E probably benign Het
Ryk T C 9: 102,746,518 (GRCm39) V151A probably benign Het
Ryr3 T A 2: 112,465,660 (GRCm39) N4838I possibly damaging Het
Sbno1 G A 5: 124,517,413 (GRCm39) R1233* probably null Het
Scn2a A T 2: 65,594,932 (GRCm39) K1927M probably damaging Het
Sec22c A T 9: 121,513,860 (GRCm39) I259N probably damaging Het
Stk38 G A 17: 29,207,210 (GRCm39) T111I probably damaging Het
Tmem237 G A 1: 59,147,215 (GRCm39) T306I probably damaging Het
Tmprss11a T C 5: 86,576,501 (GRCm39) K117E probably benign Het
Tmprss9 A T 10: 80,730,640 (GRCm39) D722V probably damaging Het
Trpc1 T C 9: 95,592,250 (GRCm39) Y575C probably damaging Het
Ube2d2b A G 5: 107,978,438 (GRCm39) M30V probably benign Het
Usp36 A T 11: 118,159,461 (GRCm39) L661* probably null Het
Vmn2r13 G T 5: 109,304,064 (GRCm39) T789N probably damaging Het
Vmn2r5 T C 3: 64,400,018 (GRCm39) T550A probably benign Het
Xirp2 T C 2: 67,355,540 (GRCm39) S3434P possibly damaging Het
Zfp106 A G 2: 120,351,007 (GRCm39) V1571A probably damaging Het
Zfp438 A G 18: 5,213,501 (GRCm39) S486P possibly damaging Het
Zfp616 A G 11: 73,975,660 (GRCm39) H643R probably damaging Het
Zfp616 A G 11: 73,976,596 (GRCm39) K955R possibly damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGGGGTTCAAAGCC -3'
(R):5'- ATCCCCTTTCCTGAAGAAGGC -3'

Sequencing Primer
(F):5'- GGGTTCAAAGCCAATATCGTAAATG -3'
(R):5'- TCCTCAATTTGACAGGCG -3'
Posted On 2022-07-18