Incidental Mutation 'R9530:Tbc1d32'
ID 719444
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.903) question?
Stock # R9530 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 56014293-56228689 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56196411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 308 (E308G)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect probably damaging
Transcript: ENSMUST00000099739
AA Change: E308G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: E308G

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,624,741 N96S possibly damaging Het
4931406P16Rik A G 7: 34,263,644 V201A probably benign Het
Acsl6 C T 11: 54,329,957 T301I probably damaging Het
Ankrd7 C A 6: 18,868,259 Q127K probably benign Het
Ap1s1 T C 5: 137,035,758 M155V probably benign Het
Appbp2 A C 11: 85,216,480 C61W probably damaging Het
Ccng1 A G 11: 40,754,058 V4A probably benign Het
Cd163 G T 6: 124,317,532 E550* probably null Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cyp2c69 A G 19: 39,859,867 S304P possibly damaging Het
Erbb3 T C 10: 128,574,422 I656V probably benign Het
Fam214b C T 4: 43,034,753 R322Q probably damaging Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Heatr1 G A 13: 12,424,726 R1395H probably damaging Het
Herc4 T C 10: 63,290,603 I578T probably benign Het
Herc6 T A 6: 57,625,914 L526* probably null Het
Ighv5-9 A G 12: 113,662,057 M22T probably benign Het
Klhl36 A G 8: 119,865,069 E17G possibly damaging Het
Mast2 A C 4: 116,312,338 L766R probably damaging Het
Megf8 G A 7: 25,330,699 V420M probably benign Het
Met T C 6: 17,558,832 V1153A probably damaging Het
Mrpl21 T A 19: 3,290,998 I196N possibly damaging Het
Olfr836 G A 9: 19,121,755 V264I probably benign Het
Polrmt C T 10: 79,738,711 A883T probably benign Het
Prkcg G A 7: 3,327,449 D537N possibly damaging Het
Rpap3 A T 15: 97,681,774 D452E probably benign Het
Slc8a2 A G 7: 16,145,344 D585G probably null Het
St18 T A 1: 6,802,773 I244N probably benign Het
Stat1 T A 1: 52,148,001 probably null Het
Stk39 A G 2: 68,368,411 Y288H probably damaging Het
Tas2r140 G A 6: 133,055,531 S88F probably benign Het
Tcf7l1 T C 6: 72,627,704 T486A probably benign Het
Tie1 T C 4: 118,486,620 T42A possibly damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Triobp G C 15: 79,002,121 G1867R probably damaging Het
Vmn1r234 A G 17: 21,228,842 H6R probably damaging Het
Vmn2r93 T A 17: 18,298,300 I7N probably damaging Het
Vwa8 T A 14: 78,935,199 S294T probably benign Het
Wdr60 A G 12: 116,211,791 I922T possibly damaging Het
Yjefn3 A G 8: 69,887,983 V197A probably benign Het
Zcchc4 CAGAG CAG 5: 52,796,226 probably null Het
Zfhx3 A G 8: 108,800,378 E969G probably damaging Het
Zfp112 G T 7: 24,125,240 C215F probably benign Het
Zfp994 A T 17: 22,201,533 L145Q probably damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 56028077 missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56196592 missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 56087559 missense probably benign 0.01
R9018:Tbc1d32 UTSW 10 56072597 missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56161145 missense possibly damaging 0.92
R9616:Tbc1d32 UTSW 10 56161150 missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56170881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTTGGGGAGAACCATTTACAC -3'
(R):5'- CCAATGTGACCCGCTTACTG -3'

Sequencing Primer
(F):5'- TACAGAAGGTATTGCCCCTGG -3'
(R):5'- GTGACCCGCTTACTGAAAAAGGTATC -3'
Posted On 2022-07-18