Incidental Mutation 'R9531:Steap4'
ID 719475
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tiarp, Tnfaip9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9531 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 7960457-7982213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7978424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 334 (D334G)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect probably benign
Transcript: ENSMUST00000115421
AA Change: D334G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: D334G

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2b T A 9: 119,431,326 D354E probably benign Het
Atf7ip T G 6: 136,560,877 S369R probably benign Het
B4galnt3 A G 6: 120,203,841 M977T probably damaging Het
Bin1 A T 18: 32,377,486 E27V probably benign Het
Cacna1a T A 8: 84,594,172 F1586L probably benign Het
Cdh18 T A 15: 23,436,476 S473T probably benign Het
Chd7 T C 4: 8,858,489 M151T Het
Dhodh T C 8: 109,594,991 T300A probably benign Het
Etl4 A G 2: 20,290,007 M1V probably null Het
Ezh1 G A 11: 101,213,831 T130M probably damaging Het
Fshb T C 2: 107,057,347 D109G probably benign Het
Grm5 T C 7: 88,130,867 *1204R probably null Het
Itpkb T G 1: 180,333,809 V500G probably benign Het
Jakmip1 C A 5: 37,175,063 T1029N probably damaging Het
Kdsr T C 1: 106,739,333 K231E probably damaging Het
Klb G A 5: 65,383,605 V1014I Het
Kng2 A G 16: 23,012,157 I134T possibly damaging Het
Lct T C 1: 128,307,861 S470G probably benign Het
Med1 A G 11: 98,157,495 V825A probably damaging Het
Mfap3l C G 8: 60,656,753 D54E probably damaging Het
Mrc2 A G 11: 105,349,905 M1474V possibly damaging Het
Mrpl15 T C 1: 4,777,534 R181G probably benign Het
Nek4 T C 14: 30,970,350 V377A probably benign Het
Olfr1480 T C 19: 13,530,572 F344L probably benign Het
Pgap3 A G 11: 98,397,997 S111P probably damaging Het
Piezo2 G A 18: 63,102,165 T787M possibly damaging Het
Pik3c2g A C 6: 139,896,200 K777T Het
Pkd1 C T 17: 24,573,140 T1267I probably damaging Het
Ros1 T C 10: 52,130,967 D835G probably damaging Het
Slc4a10 T A 2: 62,268,810 I634N probably damaging Het
Slc8a3 A T 12: 81,315,223 I274N probably damaging Het
Tbc1d30 A G 10: 121,347,200 L111P probably damaging Het
Ttc24 A G 3: 88,071,109 S252P possibly damaging Het
Ubr4 A G 4: 139,407,906 T850A probably benign Het
Zbbx A G 3: 75,078,558 S396P probably damaging Het
Zkscan2 A T 7: 123,489,614 I478N probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
R8861:Steap4 UTSW 5 7975672 missense probably benign 0.00
R9287:Steap4 UTSW 5 7976683 missense probably benign 0.05
R9423:Steap4 UTSW 5 7976720 missense probably damaging 0.99
R9504:Steap4 UTSW 5 7980538 missense probably benign 0.00
R9566:Steap4 UTSW 5 7975646 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAGTAGTTTCCAAAGCTGTTCG -3'
(R):5'- GAACTGCTAATGATGTGACTAGGG -3'

Sequencing Primer
(F):5'- CCAAAGCTGTTCGTAAGTGGTC -3'
(R):5'- TGCTAATGATGTGACTAGGGAAGTAC -3'
Posted On 2022-07-18