Mutagenetix > Incidental Mutation

Incidental Mutation 'R9531:Mrc2'

719492

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9531 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105183469-105241965 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105240731 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1474 (M1474V)

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100335
AA Change: M1474V

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: M1474V

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr2b	T	A	9: 119,260,392 (GRCm39)	D354E	probably benign	Het
Atf7ip	T	G	6: 136,537,875 (GRCm39)	S369R	probably benign	Het
B4galnt3	A	G	6: 120,180,802 (GRCm39)	M977T	probably damaging	Het
Bin1	A	T	18: 32,510,539 (GRCm39)	E27V	probably benign	Het
Cacna1a	T	A	8: 85,320,801 (GRCm39)	F1586L	probably benign	Het
Cdh18	T	A	15: 23,436,562 (GRCm39)	S473T	probably benign	Het
Chd7	T	C	4: 8,858,489 (GRCm39)	M151T		Het
Dhodh	T	C	8: 110,321,623 (GRCm39)	T300A	probably benign	Het
Etl4	A	G	2: 20,294,818 (GRCm39)	M1V	probably null	Het
Ezh1	G	A	11: 101,104,657 (GRCm39)	T130M	probably damaging	Het
Fshb	T	C	2: 106,887,692 (GRCm39)	D109G	probably benign	Het
Grm5	T	C	7: 87,780,075 (GRCm39)	*1204R	probably null	Het
Itpkb	T	G	1: 180,161,374 (GRCm39)	V500G	probably benign	Het
Jakmip1	C	A	5: 37,332,407 (GRCm39)	T1029N	probably damaging	Het
Kdsr	T	C	1: 106,667,063 (GRCm39)	K231E	probably damaging	Het
Klb	G	A	5: 65,540,948 (GRCm39)	V1014I		Het
Kng2	A	G	16: 22,830,907 (GRCm39)	I134T	possibly damaging	Het
Lct	T	C	1: 128,235,598 (GRCm39)	S470G	probably benign	Het
Med1	A	G	11: 98,048,321 (GRCm39)	V825A	probably damaging	Het
Mfap3l	C	G	8: 61,109,787 (GRCm39)	D54E	probably damaging	Het
Mrpl15	T	C	1: 4,847,757 (GRCm39)	R181G	probably benign	Het
Nek4	T	C	14: 30,692,307 (GRCm39)	V377A	probably benign	Het
Or5b121	T	C	19: 13,507,936 (GRCm39)	F344L	probably benign	Het
Pgap3	A	G	11: 98,288,823 (GRCm39)	S111P	probably damaging	Het
Piezo2	G	A	18: 63,235,236 (GRCm39)	T787M	possibly damaging	Het
Pik3c2g	A	C	6: 139,841,926 (GRCm39)	K777T		Het
Pkd1	C	T	17: 24,792,114 (GRCm39)	T1267I	probably damaging	Het
Ros1	T	C	10: 52,007,063 (GRCm39)	D835G	probably damaging	Het
Slc4a10	T	A	2: 62,099,154 (GRCm39)	I634N	probably damaging	Het
Slc8a3	A	T	12: 81,361,997 (GRCm39)	I274N	probably damaging	Het
Steap4	A	G	5: 8,028,424 (GRCm39)	D334G	probably benign	Het
Tbc1d30	A	G	10: 121,183,105 (GRCm39)	L111P	probably damaging	Het
Ttc24	A	G	3: 87,978,416 (GRCm39)	S252P	possibly damaging	Het
Ubr4	A	G	4: 139,135,217 (GRCm39)	T850A	probably benign	Het
Zbbx	A	G	3: 74,985,865 (GRCm39)	S396P	probably damaging	Het
Zkscan2	A	T	7: 123,088,837 (GRCm39)	I478N	probably damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105,219,567 (GRCm39)	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105,238,469 (GRCm39)	nonsense	probably null
IGL01751:Mrc2	APN	11	105,216,560 (GRCm39)	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105,227,503 (GRCm39)	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105,227,533 (GRCm39)	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105,224,446 (GRCm39)	splice site	probably benign
IGL02940:Mrc2	APN	11	105,231,997 (GRCm39)	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105,216,397 (GRCm39)	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105,238,692 (GRCm39)	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105,238,518 (GRCm39)	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105,231,647 (GRCm39)	missense	probably benign
R1233:Mrc2	UTSW	11	105,239,241 (GRCm39)	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R1458:Mrc2	UTSW	11	105,228,598 (GRCm39)	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105,238,551 (GRCm39)	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105,227,482 (GRCm39)	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105,229,619 (GRCm39)	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105,228,546 (GRCm39)	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105,238,682 (GRCm39)	splice site	probably null
R2165:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2265:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2266:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2267:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2268:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2269:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2270:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2271:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2272:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2296:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2298:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2300:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2326:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2518:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2519:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2520:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2895:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3029:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3030:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3079:Mrc2	UTSW	11	105,227,539 (GRCm39)	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3149:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3150:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3420:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3422:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3441:Mrc2	UTSW	11	105,238,542 (GRCm39)	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3731:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3800:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3820:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3821:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3837:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3838:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3849:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105,238,058 (GRCm39)	splice site	probably benign
R3932:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3933:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3971:Mrc2	UTSW	11	105,218,857 (GRCm39)	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4107:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4113:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4274:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4399:Mrc2	UTSW	11	105,227,484 (GRCm39)	nonsense	probably null
R4477:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4478:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4493:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4494:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4495:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4547:Mrc2	UTSW	11	105,227,467 (GRCm39)	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4601:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4602:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4603:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4610:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4611:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4637:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4672:Mrc2	UTSW	11	105,233,923 (GRCm39)	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4675:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4693:Mrc2	UTSW	11	105,234,528 (GRCm39)	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4707:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4791:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4792:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4888:Mrc2	UTSW	11	105,232,034 (GRCm39)	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105,234,408 (GRCm39)	missense	probably benign
R5600:Mrc2	UTSW	11	105,224,492 (GRCm39)	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105,227,040 (GRCm39)	nonsense	probably null
R5692:Mrc2	UTSW	11	105,227,468 (GRCm39)	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105,223,169 (GRCm39)	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105,228,639 (GRCm39)	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105,237,615 (GRCm39)	missense	probably benign
R6146:Mrc2	UTSW	11	105,216,470 (GRCm39)	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105,237,646 (GRCm39)	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105,240,669 (GRCm39)	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105,240,708 (GRCm39)	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105,233,906 (GRCm39)	splice site	probably null
R6680:Mrc2	UTSW	11	105,216,579 (GRCm39)	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105,219,244 (GRCm39)	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105,239,461 (GRCm39)	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105,223,062 (GRCm39)	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105,216,629 (GRCm39)	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105,220,061 (GRCm39)	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105,183,609 (GRCm39)	start gained	probably benign
R7537:Mrc2	UTSW	11	105,183,623 (GRCm39)	missense	probably benign
R7640:Mrc2	UTSW	11	105,223,121 (GRCm39)	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105,237,285 (GRCm39)	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105,223,092 (GRCm39)	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105,238,829 (GRCm39)	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105,239,181 (GRCm39)	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105,234,333 (GRCm39)	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105,238,132 (GRCm39)	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105,240,596 (GRCm39)	missense	probably benign
R8787:Mrc2	UTSW	11	105,238,465 (GRCm39)	missense	probably benign
R8925:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105,229,740 (GRCm39)	missense	probably benign
R9017:Mrc2	UTSW	11	105,216,711 (GRCm39)	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105,220,093 (GRCm39)	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105,234,559 (GRCm39)	missense	probably benign	0.03
T0970:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105,238,301 (GRCm39)	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105,238,186 (GRCm39)	nonsense	probably null
Z1176:Mrc2	UTSW	11	105,232,202 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGTCCCTGTGGTCATGACTG -3'
(R):5'- CCAAGGGTTGCCATCCAAAGAC -3'

Sequencing Primer
(F):5'- ACTGGGGCCTGATGTGAACTC -3'
(R):5'- GGGTTGCCATCCAAAGACAACTG -3'

Posted On

2022-07-18