Incidental Mutation 'R9532:Frmpd1'
ID 719514
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene Name FERM and PDZ domain containing 1
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9532 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 45184875-45285936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45278886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 537 (E537V)
Ref Sequence ENSEMBL: ENSMUSP00000047232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
AlphaFold A2AKB4
Predicted Effect
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: E537V

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107804
AA Change: E537V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: E537V

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,350,397 (GRCm39) N165S unknown Het
9530002B09Rik C A 4: 122,596,133 (GRCm39) N121K unknown Het
Abca1 A T 4: 53,109,284 (GRCm39) N141K probably benign Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 94,470,889 (GRCm39) probably benign Het
Bco2 T C 9: 50,457,371 (GRCm39) N57S probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Cacna1a T A 8: 85,338,246 (GRCm39) W1709R probably damaging Het
Cep95 A G 11: 106,687,042 (GRCm39) E117G probably damaging Het
D17H6S53E T A 17: 35,346,145 (GRCm39) S19T possibly damaging Het
Dab2 G T 15: 6,451,762 (GRCm39) R126L probably damaging Het
Diaph3 T C 14: 86,893,916 (GRCm39) D31G probably damaging Het
Espl1 T A 15: 102,228,260 (GRCm39) L1678* probably null Het
Fam171b T C 2: 83,710,212 (GRCm39) V628A probably damaging Het
Fgf8 A T 19: 45,725,679 (GRCm39) V186E probably damaging Het
Fmnl2 A T 2: 53,006,941 (GRCm39) Y751F unknown Het
Garin3 A G 11: 46,297,673 (GRCm39) T326A Het
Grin1 C T 2: 25,187,909 (GRCm39) G529D probably damaging Het
Heatr1 C T 13: 12,429,306 (GRCm39) T872I possibly damaging Het
Hectd4 T C 5: 121,502,616 (GRCm39) I4240T probably benign Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Hyls1 T A 9: 35,473,398 (GRCm39) Q6L probably benign Het
Igfn1 A T 1: 135,897,229 (GRCm39) D1112E possibly damaging Het
Ighv1-82 T G 12: 115,916,158 (GRCm39) R117S probably damaging Het
Iqch G A 9: 63,389,935 (GRCm39) A748V Het
Kcnd2 G T 6: 21,727,180 (GRCm39) A578S probably benign Het
Klc2 A G 19: 5,161,565 (GRCm39) V315A possibly damaging Het
Klhl20 A T 1: 160,937,329 (GRCm39) D15E probably benign Het
Lamb2 G T 9: 108,365,830 (GRCm39) G1445W probably damaging Het
Lhx4 T A 1: 155,586,024 (GRCm39) I96F probably damaging Het
Lyzl6 T C 11: 103,522,168 (GRCm39) T143A probably benign Het
Nup93 G A 8: 95,041,249 (GRCm39) A796T probably damaging Het
Nutm2 T C 13: 50,628,475 (GRCm39) V513A probably benign Het
Or51s1 A G 7: 102,558,746 (GRCm39) V100A probably benign Het
Or52e4 A T 7: 104,706,275 (GRCm39) H274L probably damaging Het
Pcdh8 A G 14: 80,008,206 (GRCm39) V119A possibly damaging Het
Pkmyt1 T C 17: 23,954,691 (GRCm39) I427T probably benign Het
Polr1g A T 7: 19,091,817 (GRCm39) S97T possibly damaging Het
Polr3c T C 3: 96,629,866 (GRCm39) D222G probably null Het
Prickle2 A T 6: 92,683,096 (GRCm39) S11T probably benign Het
Prpf8 G A 11: 75,385,608 (GRCm39) A930T probably benign Het
Prss40 G T 1: 34,597,106 (GRCm39) H147Q probably damaging Het
Prune2 A T 19: 17,099,794 (GRCm39) D1766V probably benign Het
Qrich1 C T 9: 108,411,519 (GRCm39) T348M probably benign Het
Slc20a1 T C 2: 129,041,933 (GRCm39) Y99H probably damaging Het
Slc6a15 T C 10: 103,240,333 (GRCm39) V352A probably damaging Het
Ttll3 A G 6: 113,385,970 (GRCm39) Q601R possibly damaging Het
Virma T C 4: 11,507,078 (GRCm39) probably null Het
Washc4 A G 10: 83,417,258 (GRCm39) probably benign Het
Zdhhc18 A T 4: 133,342,541 (GRCm39) M191K possibly damaging Het
Zfp281 A G 1: 136,554,894 (GRCm39) N624S probably benign Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45,279,456 (GRCm39) missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45,243,717 (GRCm39) missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45,284,239 (GRCm39) missense probably benign
IGL02305:Frmpd1 APN 4 45,249,209 (GRCm39) missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45,270,023 (GRCm39) splice site probably null
IGL02586:Frmpd1 APN 4 45,285,160 (GRCm39) missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45,285,082 (GRCm39) missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45,285,493 (GRCm39) missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45,261,926 (GRCm39) missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45,279,140 (GRCm39) missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45,284,383 (GRCm39) missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45,283,993 (GRCm39) missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45,284,899 (GRCm39) nonsense probably null
R0103:Frmpd1 UTSW 4 45,229,884 (GRCm39) missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45,229,884 (GRCm39) missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45,279,340 (GRCm39) missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45,279,340 (GRCm39) missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45,284,196 (GRCm39) missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45,284,938 (GRCm39) missense unknown
R0524:Frmpd1 UTSW 4 45,283,774 (GRCm39) missense probably benign 0.00
R0524:Frmpd1 UTSW 4 45,256,902 (GRCm39) missense probably damaging 1.00
R0625:Frmpd1 UTSW 4 45,284,055 (GRCm39) missense probably benign
R0825:Frmpd1 UTSW 4 45,285,394 (GRCm39) missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45,268,497 (GRCm39) missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45,279,000 (GRCm39) missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45,273,197 (GRCm39) missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45,273,197 (GRCm39) missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45,283,932 (GRCm39) missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45,283,711 (GRCm39) missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45,285,408 (GRCm39) missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45,278,969 (GRCm39) missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45,244,667 (GRCm39) missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45,283,698 (GRCm39) missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45,284,093 (GRCm39) missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45,284,382 (GRCm39) missense probably benign
R4597:Frmpd1 UTSW 4 45,274,441 (GRCm39) missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45,284,785 (GRCm39) missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45,229,865 (GRCm39) missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45,273,099 (GRCm39) missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45,261,931 (GRCm39) splice site probably null
R5041:Frmpd1 UTSW 4 45,278,878 (GRCm39) missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45,284,322 (GRCm39) missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45,249,196 (GRCm39) missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45,243,697 (GRCm39) missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45,284,915 (GRCm39) missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45,285,401 (GRCm39) missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45,268,551 (GRCm39) missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45,274,489 (GRCm39) missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45,279,024 (GRCm39) missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45,284,664 (GRCm39) missense probably benign
R6748:Frmpd1 UTSW 4 45,274,397 (GRCm39) missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45,284,850 (GRCm39) missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45,275,383 (GRCm39) missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45,284,200 (GRCm39) missense probably benign
R7258:Frmpd1 UTSW 4 45,269,974 (GRCm39) missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45,285,700 (GRCm39) missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45,278,880 (GRCm39) missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45,256,948 (GRCm39) missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45,279,558 (GRCm39) missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45,285,237 (GRCm39) missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45,271,181 (GRCm39) missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45,279,098 (GRCm39) missense probably damaging 1.00
R7719:Frmpd1 UTSW 4 45,284,841 (GRCm39) missense possibly damaging 0.52
R7724:Frmpd1 UTSW 4 45,229,888 (GRCm39) missense probably damaging 1.00
R7891:Frmpd1 UTSW 4 45,284,478 (GRCm39) missense probably benign 0.06
R8010:Frmpd1 UTSW 4 45,284,272 (GRCm39) missense possibly damaging 0.51
R8260:Frmpd1 UTSW 4 45,244,638 (GRCm39) missense probably damaging 0.99
R8528:Frmpd1 UTSW 4 45,285,034 (GRCm39) missense probably benign
R8794:Frmpd1 UTSW 4 45,279,632 (GRCm39) missense probably benign 0.00
R8798:Frmpd1 UTSW 4 45,285,424 (GRCm39) missense possibly damaging 0.95
R8954:Frmpd1 UTSW 4 45,284,702 (GRCm39) missense probably benign 0.02
R9058:Frmpd1 UTSW 4 45,283,948 (GRCm39) missense probably damaging 1.00
R9178:Frmpd1 UTSW 4 45,285,367 (GRCm39) missense probably damaging 1.00
R9281:Frmpd1 UTSW 4 45,284,127 (GRCm39) missense probably benign 0.11
R9408:Frmpd1 UTSW 4 45,279,182 (GRCm39) missense probably benign 0.00
Z1088:Frmpd1 UTSW 4 45,284,080 (GRCm39) missense possibly damaging 0.93
Z1177:Frmpd1 UTSW 4 45,275,272 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGTCAGTCGCTTTCTG -3'
(R):5'- TCTAAGTCGTCCTCTTCCAGGG -3'

Sequencing Primer
(F):5'- AGGTCAGTCGCTTTCTGTATTC -3'
(R):5'- TCCATGGACTCACTGGACC -3'
Posted On 2022-07-18