Mutagenetix > Incidental Mutation

Incidental Mutation 'R9532:Kcnd2'

719520

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R9532 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 21727181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 578 (A578S)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably benign
Transcript: ENSMUST00000081542
AA Change: A578S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: A578S

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	C	3: 124,556,748	N165S	unknown	Het
9530002B09Rik	C	A	4: 122,702,340	N121K	unknown	Het
Abca1	A	T	4: 53,109,284	N141K	probably benign	Het
Amer1	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	X: 95,427,283		probably benign	Het
Bco2	T	C	9: 50,546,071	N57S	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Cacna1a	T	A	8: 84,611,617	W1709R	probably damaging	Het
Cd3eap	A	T	7: 19,357,892	S97T	possibly damaging	Het
Cep95	A	G	11: 106,796,216	E117G	probably damaging	Het
D17H6S53E	T	A	17: 35,127,169	S19T	possibly damaging	Het
Dab2	G	T	15: 6,422,281	R126L	probably damaging	Het
Diaph3	T	C	14: 86,656,480	D31G	probably damaging	Het
Espl1	T	A	15: 102,319,825	L1678*	probably null	Het
Fam171b	T	C	2: 83,879,868	V628A	probably damaging	Het
Fam71b	A	G	11: 46,406,846	T326A		Het
Fgf8	A	T	19: 45,737,240	V186E	probably damaging	Het
Fmnl2	A	T	2: 53,116,929	Y751F	unknown	Het
Frmpd1	A	T	4: 45,278,886	E537V		Het
Grin1	C	T	2: 25,297,897	G529D	probably damaging	Het
Heatr1	C	T	13: 12,414,425	T872I	possibly damaging	Het
Hectd4	T	C	5: 121,364,553	I4240T	probably benign	Het
Hpd	C	T	5: 123,174,469	R279H	possibly damaging	Het
Hyls1	T	A	9: 35,562,102	Q6L	probably benign	Het
Igfn1	A	T	1: 135,969,491	D1112E	possibly damaging	Het
Ighv1-82	T	G	12: 115,952,538	R117S	probably damaging	Het
Iqch	G	A	9: 63,482,653	A748V		Het
Klc2	A	G	19: 5,111,537	V315A	possibly damaging	Het
Klhl20	A	T	1: 161,109,759	D15E	probably benign	Het
Lamb2	G	T	9: 108,488,631	G1445W	probably damaging	Het
Lhx4	T	A	1: 155,710,278	I96F	probably damaging	Het
Lyzl6	T	C	11: 103,631,342	T143A	probably benign	Het
Nup93	G	A	8: 94,314,621	A796T	probably damaging	Het
Nutm2	T	C	13: 50,474,439	V513A	probably benign	Het
Olfr571	A	G	7: 102,909,539	V100A	probably benign	Het
Olfr677	A	T	7: 105,057,068	H274L	probably damaging	Het
Pcdh8	A	G	14: 79,770,766	V119A	possibly damaging	Het
Pkmyt1	T	C	17: 23,735,717	I427T	probably benign	Het
Polr3c	T	C	3: 96,722,550	D222G	probably null	Het
Prickle2	A	T	6: 92,706,115	S11T	probably benign	Het
Prpf8	G	A	11: 75,494,782	A930T	probably benign	Het
Prss40	G	T	1: 34,558,025	H147Q	probably damaging	Het
Prune2	A	T	19: 17,122,430	D1766V	probably benign	Het
Qrich1	C	T	9: 108,534,320	T348M	probably benign	Het
Slc20a1	T	C	2: 129,200,013	Y99H	probably damaging	Het
Slc6a15	T	C	10: 103,404,472	V352A	probably damaging	Het
Ttll3	A	G	6: 113,409,009	Q601R	possibly damaging	Het
Virma	T	C	4: 11,507,078		probably null	Het
Washc4	A	G	10: 83,581,394		probably benign	Het
Zdhhc18	A	T	4: 133,615,230	M191K	possibly damaging	Het
Zfp281	A	G	1: 136,627,156	N624S	probably benign	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTGAACCAAGTTGAGCAGAATC -3'
(R):5'- GCGGCAATTGTCTTACAAGG -3'

Sequencing Primer
(F):5'- ACCAAGTTGAGCAGAATCTTAGG -3'
(R):5'- CGGCAATTGTCTTACAAGGCAGAC -3'

Posted On

2022-07-18