Incidental Mutation 'R9532:Ttll3'
ID 719521
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms 4833441J24Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9532 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 113366221-113391548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113385970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 601 (Q601R)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect possibly damaging
Transcript: ENSMUST00000032414
AA Change: Q601R

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: Q601R

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: Q602R

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: Q602R

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,350,397 (GRCm39) N165S unknown Het
9530002B09Rik C A 4: 122,596,133 (GRCm39) N121K unknown Het
Abca1 A T 4: 53,109,284 (GRCm39) N141K probably benign Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 94,470,889 (GRCm39) probably benign Het
Bco2 T C 9: 50,457,371 (GRCm39) N57S probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Cacna1a T A 8: 85,338,246 (GRCm39) W1709R probably damaging Het
Cep95 A G 11: 106,687,042 (GRCm39) E117G probably damaging Het
D17H6S53E T A 17: 35,346,145 (GRCm39) S19T possibly damaging Het
Dab2 G T 15: 6,451,762 (GRCm39) R126L probably damaging Het
Diaph3 T C 14: 86,893,916 (GRCm39) D31G probably damaging Het
Espl1 T A 15: 102,228,260 (GRCm39) L1678* probably null Het
Fam171b T C 2: 83,710,212 (GRCm39) V628A probably damaging Het
Fgf8 A T 19: 45,725,679 (GRCm39) V186E probably damaging Het
Fmnl2 A T 2: 53,006,941 (GRCm39) Y751F unknown Het
Frmpd1 A T 4: 45,278,886 (GRCm39) E537V Het
Garin3 A G 11: 46,297,673 (GRCm39) T326A Het
Grin1 C T 2: 25,187,909 (GRCm39) G529D probably damaging Het
Heatr1 C T 13: 12,429,306 (GRCm39) T872I possibly damaging Het
Hectd4 T C 5: 121,502,616 (GRCm39) I4240T probably benign Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Hyls1 T A 9: 35,473,398 (GRCm39) Q6L probably benign Het
Igfn1 A T 1: 135,897,229 (GRCm39) D1112E possibly damaging Het
Ighv1-82 T G 12: 115,916,158 (GRCm39) R117S probably damaging Het
Iqch G A 9: 63,389,935 (GRCm39) A748V Het
Kcnd2 G T 6: 21,727,180 (GRCm39) A578S probably benign Het
Klc2 A G 19: 5,161,565 (GRCm39) V315A possibly damaging Het
Klhl20 A T 1: 160,937,329 (GRCm39) D15E probably benign Het
Lamb2 G T 9: 108,365,830 (GRCm39) G1445W probably damaging Het
Lhx4 T A 1: 155,586,024 (GRCm39) I96F probably damaging Het
Lyzl6 T C 11: 103,522,168 (GRCm39) T143A probably benign Het
Nup93 G A 8: 95,041,249 (GRCm39) A796T probably damaging Het
Nutm2 T C 13: 50,628,475 (GRCm39) V513A probably benign Het
Or51s1 A G 7: 102,558,746 (GRCm39) V100A probably benign Het
Or52e4 A T 7: 104,706,275 (GRCm39) H274L probably damaging Het
Pcdh8 A G 14: 80,008,206 (GRCm39) V119A possibly damaging Het
Pkmyt1 T C 17: 23,954,691 (GRCm39) I427T probably benign Het
Polr1g A T 7: 19,091,817 (GRCm39) S97T possibly damaging Het
Polr3c T C 3: 96,629,866 (GRCm39) D222G probably null Het
Prickle2 A T 6: 92,683,096 (GRCm39) S11T probably benign Het
Prpf8 G A 11: 75,385,608 (GRCm39) A930T probably benign Het
Prss40 G T 1: 34,597,106 (GRCm39) H147Q probably damaging Het
Prune2 A T 19: 17,099,794 (GRCm39) D1766V probably benign Het
Qrich1 C T 9: 108,411,519 (GRCm39) T348M probably benign Het
Slc20a1 T C 2: 129,041,933 (GRCm39) Y99H probably damaging Het
Slc6a15 T C 10: 103,240,333 (GRCm39) V352A probably damaging Het
Virma T C 4: 11,507,078 (GRCm39) probably null Het
Washc4 A G 10: 83,417,258 (GRCm39) probably benign Het
Zdhhc18 A T 4: 133,342,541 (GRCm39) M191K possibly damaging Het
Zfp281 A G 1: 136,554,894 (GRCm39) N624S probably benign Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113,371,690 (GRCm39) missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113,389,945 (GRCm39) missense probably benign
IGL01697:Ttll3 APN 6 113,376,690 (GRCm39) missense probably benign 0.00
IGL01944:Ttll3 APN 6 113,391,076 (GRCm39) missense probably benign
IGL02688:Ttll3 APN 6 113,376,700 (GRCm39) missense probably benign 0.00
IGL03068:Ttll3 APN 6 113,386,158 (GRCm39) missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113,375,738 (GRCm39) missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113,386,300 (GRCm39) missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113,385,864 (GRCm39) critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113,369,725 (GRCm39) missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113,375,731 (GRCm39) missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113,386,003 (GRCm39) missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113,389,895 (GRCm39) missense probably benign 0.31
R2896:Ttll3 UTSW 6 113,369,683 (GRCm39) missense probably benign 0.15
R2903:Ttll3 UTSW 6 113,384,284 (GRCm39) missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113,369,471 (GRCm39) unclassified probably benign
R4659:Ttll3 UTSW 6 113,391,102 (GRCm39) missense probably benign
R4746:Ttll3 UTSW 6 113,384,353 (GRCm39) missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113,389,901 (GRCm39) missense probably benign 0.00
R5358:Ttll3 UTSW 6 113,378,292 (GRCm39) missense probably benign 0.26
R5372:Ttll3 UTSW 6 113,378,382 (GRCm39) nonsense probably null
R5525:Ttll3 UTSW 6 113,389,939 (GRCm39) missense probably benign
R5548:Ttll3 UTSW 6 113,370,078 (GRCm39) missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113,376,669 (GRCm39) missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113,374,992 (GRCm39) nonsense probably null
R6119:Ttll3 UTSW 6 113,371,702 (GRCm39) missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113,369,524 (GRCm39) missense probably benign 0.00
R6719:Ttll3 UTSW 6 113,375,993 (GRCm39) intron probably benign
R6852:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,116 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6853:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6854:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7170:Ttll3 UTSW 6 113,390,839 (GRCm39) missense probably benign 0.41
R7239:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7302:Ttll3 UTSW 6 113,386,246 (GRCm39) missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113,376,125 (GRCm39) frame shift probably null
R7330:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7586:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7587:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7701:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7702:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7776:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7793:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7797:Ttll3 UTSW 6 113,371,738 (GRCm39) missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7826:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,123 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7831:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7832:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7833:Ttll3 UTSW 6 113,386,298 (GRCm39) missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R8344:Ttll3 UTSW 6 113,371,959 (GRCm39) missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113,371,734 (GRCm39) missense probably benign 0.04
R8768:Ttll3 UTSW 6 113,385,949 (GRCm39) missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113,389,850 (GRCm39) missense probably benign 0.00
R9036:Ttll3 UTSW 6 113,376,657 (GRCm39) missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9271:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9329:Ttll3 UTSW 6 113,369,635 (GRCm39) missense probably benign
R9535:Ttll3 UTSW 6 113,389,834 (GRCm39) missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113,386,114 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTAAGCTCACTAAAATGGCC -3'
(R):5'- GGGCTGGCATTGATTTCAATC -3'

Sequencing Primer
(F):5'- CAACCCAGGACTTTGTCTGAAG -3'
(R):5'- TGATTTCAATCAACCAGGGCTGG -3'
Posted On 2022-07-18