Incidental Mutation 'R9532:Nup93'
ID 719526
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R9532 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 94941192-95043855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 95041249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 796 (A796T)
Ref Sequence ENSEMBL: ENSMUSP00000078878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably damaging
Transcript: ENSMUST00000079961
AA Change: A796T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: A796T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109547
AA Change: A796T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: A796T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211822
AA Change: A673T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212824
AA Change: A796T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,350,397 (GRCm39) N165S unknown Het
9530002B09Rik C A 4: 122,596,133 (GRCm39) N121K unknown Het
Abca1 A T 4: 53,109,284 (GRCm39) N141K probably benign Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 94,470,889 (GRCm39) probably benign Het
Bco2 T C 9: 50,457,371 (GRCm39) N57S probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Cacna1a T A 8: 85,338,246 (GRCm39) W1709R probably damaging Het
Cep95 A G 11: 106,687,042 (GRCm39) E117G probably damaging Het
D17H6S53E T A 17: 35,346,145 (GRCm39) S19T possibly damaging Het
Dab2 G T 15: 6,451,762 (GRCm39) R126L probably damaging Het
Diaph3 T C 14: 86,893,916 (GRCm39) D31G probably damaging Het
Espl1 T A 15: 102,228,260 (GRCm39) L1678* probably null Het
Fam171b T C 2: 83,710,212 (GRCm39) V628A probably damaging Het
Fgf8 A T 19: 45,725,679 (GRCm39) V186E probably damaging Het
Fmnl2 A T 2: 53,006,941 (GRCm39) Y751F unknown Het
Frmpd1 A T 4: 45,278,886 (GRCm39) E537V Het
Garin3 A G 11: 46,297,673 (GRCm39) T326A Het
Grin1 C T 2: 25,187,909 (GRCm39) G529D probably damaging Het
Heatr1 C T 13: 12,429,306 (GRCm39) T872I possibly damaging Het
Hectd4 T C 5: 121,502,616 (GRCm39) I4240T probably benign Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Hyls1 T A 9: 35,473,398 (GRCm39) Q6L probably benign Het
Igfn1 A T 1: 135,897,229 (GRCm39) D1112E possibly damaging Het
Ighv1-82 T G 12: 115,916,158 (GRCm39) R117S probably damaging Het
Iqch G A 9: 63,389,935 (GRCm39) A748V Het
Kcnd2 G T 6: 21,727,180 (GRCm39) A578S probably benign Het
Klc2 A G 19: 5,161,565 (GRCm39) V315A possibly damaging Het
Klhl20 A T 1: 160,937,329 (GRCm39) D15E probably benign Het
Lamb2 G T 9: 108,365,830 (GRCm39) G1445W probably damaging Het
Lhx4 T A 1: 155,586,024 (GRCm39) I96F probably damaging Het
Lyzl6 T C 11: 103,522,168 (GRCm39) T143A probably benign Het
Nutm2 T C 13: 50,628,475 (GRCm39) V513A probably benign Het
Or51s1 A G 7: 102,558,746 (GRCm39) V100A probably benign Het
Or52e4 A T 7: 104,706,275 (GRCm39) H274L probably damaging Het
Pcdh8 A G 14: 80,008,206 (GRCm39) V119A possibly damaging Het
Pkmyt1 T C 17: 23,954,691 (GRCm39) I427T probably benign Het
Polr1g A T 7: 19,091,817 (GRCm39) S97T possibly damaging Het
Polr3c T C 3: 96,629,866 (GRCm39) D222G probably null Het
Prickle2 A T 6: 92,683,096 (GRCm39) S11T probably benign Het
Prpf8 G A 11: 75,385,608 (GRCm39) A930T probably benign Het
Prss40 G T 1: 34,597,106 (GRCm39) H147Q probably damaging Het
Prune2 A T 19: 17,099,794 (GRCm39) D1766V probably benign Het
Qrich1 C T 9: 108,411,519 (GRCm39) T348M probably benign Het
Slc20a1 T C 2: 129,041,933 (GRCm39) Y99H probably damaging Het
Slc6a15 T C 10: 103,240,333 (GRCm39) V352A probably damaging Het
Ttll3 A G 6: 113,385,970 (GRCm39) Q601R possibly damaging Het
Virma T C 4: 11,507,078 (GRCm39) probably null Het
Washc4 A G 10: 83,417,258 (GRCm39) probably benign Het
Zdhhc18 A T 4: 133,342,541 (GRCm39) M191K possibly damaging Het
Zfp281 A G 1: 136,554,894 (GRCm39) N624S probably benign Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 95,035,651 (GRCm39) critical splice donor site probably null
IGL01652:Nup93 APN 8 95,023,187 (GRCm39) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 95,028,737 (GRCm39) nonsense probably null
IGL02169:Nup93 APN 8 95,028,757 (GRCm39) missense probably damaging 1.00
IGL02212:Nup93 APN 8 95,038,290 (GRCm39) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,954,461 (GRCm39) nonsense probably null
IGL02568:Nup93 APN 8 95,036,263 (GRCm39) missense probably damaging 1.00
IGL03094:Nup93 APN 8 95,023,130 (GRCm39) missense probably benign
IGL03248:Nup93 APN 8 95,032,716 (GRCm39) missense probably damaging 0.98
IGL03273:Nup93 APN 8 95,032,905 (GRCm39) missense probably benign 0.01
IGL03401:Nup93 APN 8 95,036,339 (GRCm39) splice site probably null
PIT4585001:Nup93 UTSW 8 94,970,355 (GRCm39) missense probably benign 0.25
R0409:Nup93 UTSW 8 95,030,293 (GRCm39) missense probably damaging 1.00
R0748:Nup93 UTSW 8 95,034,571 (GRCm39) missense probably damaging 1.00
R0891:Nup93 UTSW 8 95,007,891 (GRCm39) splice site probably benign
R1667:Nup93 UTSW 8 95,019,315 (GRCm39) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 95,023,183 (GRCm39) missense probably benign 0.29
R1862:Nup93 UTSW 8 95,032,730 (GRCm39) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,970,367 (GRCm39) missense probably damaging 1.00
R2143:Nup93 UTSW 8 95,023,108 (GRCm39) nonsense probably null
R2187:Nup93 UTSW 8 95,027,478 (GRCm39) missense probably damaging 1.00
R2228:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2229:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,954,485 (GRCm39) critical splice donor site probably null
R2884:Nup93 UTSW 8 95,030,266 (GRCm39) missense probably damaging 1.00
R4521:Nup93 UTSW 8 95,041,264 (GRCm39) missense probably damaging 1.00
R4563:Nup93 UTSW 8 95,034,520 (GRCm39) missense probably damaging 1.00
R4900:Nup93 UTSW 8 95,013,231 (GRCm39) missense probably benign 0.25
R5570:Nup93 UTSW 8 95,041,298 (GRCm39) missense probably damaging 1.00
R6226:Nup93 UTSW 8 95,013,165 (GRCm39) missense probably damaging 1.00
R6489:Nup93 UTSW 8 95,028,716 (GRCm39) missense probably benign 0.10
R6658:Nup93 UTSW 8 95,030,807 (GRCm39) missense probably benign 0.02
R6817:Nup93 UTSW 8 95,041,310 (GRCm39) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,970,314 (GRCm39) missense probably damaging 1.00
R6955:Nup93 UTSW 8 95,036,301 (GRCm39) missense probably damaging 0.96
R7476:Nup93 UTSW 8 95,030,260 (GRCm39) missense probably damaging 1.00
R7643:Nup93 UTSW 8 95,013,247 (GRCm39) critical splice donor site probably null
R7994:Nup93 UTSW 8 95,032,930 (GRCm39) missense probably benign 0.15
R8461:Nup93 UTSW 8 95,007,963 (GRCm39) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,954,371 (GRCm39) missense probably benign 0.25
R9264:Nup93 UTSW 8 95,019,348 (GRCm39) missense probably benign 0.01
R9567:Nup93 UTSW 8 95,035,604 (GRCm39) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 95,033,267 (GRCm39) missense probably damaging 0.99
R9721:Nup93 UTSW 8 95,030,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACACCCTGTGGAATGGG -3'
(R):5'- ACTGTGGACAACATTTCCCAAG -3'

Sequencing Primer
(F):5'- CCTGTGGAATGGGGCTCC -3'
(R):5'- TCATGAGGACCTCCATCT -3'
Posted On 2022-07-18