Mutagenetix > Incidental Mutation

Incidental Mutation 'R9535:Usp40'

719636

Institutional Source

Beutler Lab

Gene Symbol

Usp40

Ensembl Gene

ENSMUSG00000005501

Gene Name

ubiquitin specific peptidase 40

Synonyms

B230215L03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001033291

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9535 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87945119-88008551 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to C at 88007439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]

AlphaFold

Q8BWR4

Predicted Effect

probably benign
Transcript: ENSMUST00000040783

SMART Domains

Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501

Domain	Start	End	E-Value	Type
Pfam:UCH	40	344	1.1e-31	PFAM
Pfam:UCH_1	41	320	1.2e-20	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187758

SMART Domains

Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501

Domain	Start	End	E-Value	Type
Pfam:UCH	40	346	8.7e-41	PFAM
Pfam:UCH_1	41	319	2.4e-22	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188332

SMART Domains

Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

Domain	Start	End	E-Value	Type
Pfam:UCH	40	70	5.9e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,610	I236V	probably benign	Het
4930583I09Rik	T	A	17: 64,834,331	R65S	unknown	Het
4931408C20Rik	A	C	1: 26,682,151	L1316*	probably null	Het
Abcc6	A	G	7: 45,977,263	S1457P	probably damaging	Het
Alad	T	C	4: 62,510,540	D259G	probably damaging	Het
Atmin	A	G	8: 116,956,588	D329G	probably damaging	Het
Cdkal1	A	G	13: 29,850,024	F29L	probably benign	Het
Chrng	C	T	1: 87,211,480	P518S	probably benign	Het
Cpa1	G	T	6: 30,641,848	D224Y	probably damaging	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dennd5b	T	C	6: 148,993,867	I1222V	probably benign	Het
Dnm1	A	T	2: 32,312,332	S773T	probably benign	Het
Fam208b	T	A	13: 3,573,559	R2130S	possibly damaging	Het
Glmn	A	T	5: 107,558,502	V419E	possibly damaging	Het
Il18rap	T	A	1: 40,547,830	V424E	probably benign	Het
Kdm6b	C	A	11: 69,406,450	G359*	probably null	Het
Krt84	A	G	15: 101,529,581		probably null	Het
Lig4	C	A	8: 9,972,325	C485F	probably damaging	Het
Mpo	T	A	11: 87,799,968	W411R	probably damaging	Het
Mpv17l	A	G	16: 13,941,285	E8G	probably benign	Het
Mrps34	T	C	17: 24,895,477	Y104H	probably benign	Het
Muc15	T	A	2: 110,731,662	W148R	probably damaging	Het
Nrg1	T	C	8: 31,949,967	D134G	probably benign	Het
Prdm1	T	C	10: 44,441,612	Y405C	probably damaging	Het
Ptprb	T	C	10: 116,322,526	S501P	possibly damaging	Het
Pwp1	C	A	10: 85,888,094	S486R	possibly damaging	Het
Rtl1	T	C	12: 109,590,737	E1556G	probably damaging	Het
Rtl1	T	C	12: 109,595,264	Q47R	unknown	Het
Siglece	A	G	7: 43,657,631	F311L	probably benign	Het
Slc27a3	A	G	3: 90,386,311	L589P	probably damaging	Het
Synrg	T	A	11: 83,990,834	M332K	probably benign	Het
Tecta	T	A	9: 42,359,463	N1183I	probably damaging	Het
Tmed11	A	G	5: 108,779,049	I119T	possibly damaging	Het
Ttll3	C	T	6: 113,412,873	R740W	probably damaging	Het
Vmn1r236	C	T	17: 21,287,156	H179Y	probably benign	Het
Wwtr1	T	C	3: 57,477,404	M298V	possibly damaging	Het
Xrcc4	T	A	13: 89,940,999	M280L	probably benign	Het

Other mutations in Usp40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Usp40	APN	1	88004238	splice site	probably benign
IGL00828:Usp40	APN	1	87978306	unclassified	probably benign
IGL01090:Usp40	APN	1	87962465	missense	probably benign	0.01
IGL01123:Usp40	APN	1	87986123	missense	probably benign	0.01
IGL01401:Usp40	APN	1	87994198	missense	probably damaging	1.00
IGL02506:Usp40	APN	1	87982016	missense	probably damaging	0.98
IGL02580:Usp40	APN	1	87980966	splice site	probably null
IGL02625:Usp40	APN	1	87950017	missense	probably benign	0.19
IGL02811:Usp40	APN	1	87995736	missense	probably damaging	1.00
IGL02958:Usp40	APN	1	87978485	missense	probably damaging	0.99
Brink	UTSW	1	87981033	missense	probably benign	0.11
void	UTSW	1	87995713	nonsense	probably null
G5030:Usp40	UTSW	1	87994219	missense	probably damaging	1.00
R0019:Usp40	UTSW	1	87978411	missense	probably benign	0.00
R0282:Usp40	UTSW	1	87980958	splice site	probably benign
R0453:Usp40	UTSW	1	87946598	makesense	probably null
R0646:Usp40	UTSW	1	87978522	missense	probably benign	0.00
R1440:Usp40	UTSW	1	87982086	missense	probably benign	0.01
R1490:Usp40	UTSW	1	87988965	nonsense	probably null
R1620:Usp40	UTSW	1	87994225	missense	probably damaging	1.00
R1881:Usp40	UTSW	1	87994271	missense	probably benign	0.08
R1903:Usp40	UTSW	1	87982056	missense	probably benign	0.15
R1912:Usp40	UTSW	1	87946646	missense	probably benign	0.00
R1919:Usp40	UTSW	1	87995842	missense	possibly damaging	0.75
R1976:Usp40	UTSW	1	87978536	missense	probably benign	0.00
R2111:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2112:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2163:Usp40	UTSW	1	87995858	splice site	probably benign
R2432:Usp40	UTSW	1	87982082	missense	probably benign
R2865:Usp40	UTSW	1	87949979	nonsense	probably null
R3885:Usp40	UTSW	1	87967269	missense	probably damaging	1.00
R4360:Usp40	UTSW	1	87952361	missense	probably damaging	1.00
R4370:Usp40	UTSW	1	87997875	missense	probably benign
R4496:Usp40	UTSW	1	87995737	missense	possibly damaging	0.69
R4714:Usp40	UTSW	1	87967179	splice site	probably null
R4888:Usp40	UTSW	1	87986201	critical splice acceptor site	probably null
R4944:Usp40	UTSW	1	87952355	missense	probably benign	0.10
R5269:Usp40	UTSW	1	87995782	missense	probably benign	0.01
R5629:Usp40	UTSW	1	87981009	missense	probably benign
R5696:Usp40	UTSW	1	87995752	missense	probably benign	0.27
R5756:Usp40	UTSW	1	87951691	missense	possibly damaging	0.66
R5887:Usp40	UTSW	1	87999870	missense	probably damaging	1.00
R5910:Usp40	UTSW	1	87968400	nonsense	probably null
R6014:Usp40	UTSW	1	87980016	missense	probably damaging	1.00
R6044:Usp40	UTSW	1	87990150	missense	probably benign
R6083:Usp40	UTSW	1	87978559	missense	probably benign	0.01
R6299:Usp40	UTSW	1	87997927	missense	probably damaging	0.99
R6625:Usp40	UTSW	1	87967213	missense	probably benign	0.01
R6757:Usp40	UTSW	1	87980037	missense	probably damaging	0.99
R6810:Usp40	UTSW	1	87981033	missense	probably benign	0.11
R7110:Usp40	UTSW	1	87986162	missense	probably benign	0.11
R7573:Usp40	UTSW	1	87986072	missense	probably benign	0.09
R7575:Usp40	UTSW	1	87949960	missense	probably damaging	1.00
R7634:Usp40	UTSW	1	87962430	nonsense	probably null
R7756:Usp40	UTSW	1	87967200	missense	probably damaging	0.99
R7767:Usp40	UTSW	1	87982178	missense	probably benign	0.01
R7861:Usp40	UTSW	1	87982130	missense	probably damaging	0.99
R7881:Usp40	UTSW	1	87995713	nonsense	probably null
R7896:Usp40	UTSW	1	87978479	missense	possibly damaging	0.77
R8119:Usp40	UTSW	1	87967678	splice site	probably null
R8354:Usp40	UTSW	1	87980972	missense	probably benign	0.00
R8358:Usp40	UTSW	1	87981048	missense	possibly damaging	0.71
R8425:Usp40	UTSW	1	87959836	missense	probably benign
R8446:Usp40	UTSW	1	87978468	missense	probably benign
R8454:Usp40	UTSW	1	87980972	missense	probably benign	0.00
R8744:Usp40	UTSW	1	87983769	missense	probably benign
R9002:Usp40	UTSW	1	88007341	missense	probably benign
R9033:Usp40	UTSW	1	87995777	utr 3 prime	probably benign
R9210:Usp40	UTSW	1	87957313	missense	possibly damaging	0.90
R9245:Usp40	UTSW	1	87950287	missense	probably benign
R9331:Usp40	UTSW	1	87974106	missense	probably damaging	1.00
R9378:Usp40	UTSW	1	87957310	missense	probably damaging	1.00
R9379:Usp40	UTSW	1	87954167	missense	probably benign
R9501:Usp40	UTSW	1	87997835	missense	probably benign	0.01
R9537:Usp40	UTSW	1	88007395	missense	probably benign	0.01
RF006:Usp40	UTSW	1	87967195	missense	possibly damaging	0.47
Z1177:Usp40	UTSW	1	87968414	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTCAGGTGTGAAATGAAGCGTC -3'
(R):5'- CACAGGTTAATCAGGACCCC -3'

Sequencing Primer
(F):5'- CAGGTGTGAAATGAAGCGTCTGAAG -3'
(R):5'- TTAATCAGGACCCCGTGTAGG -3'

Posted On

2022-07-18