Incidental Mutation 'R9535:Dennd5b'
ID 719648
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R9535 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148895365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1222 (I1222V)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: I1222V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: I1222V

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T A 17: 65,141,326 (GRCm39) R65S unknown Het
Abcc6 A G 7: 45,626,687 (GRCm39) S1457P probably damaging Het
Alad T C 4: 62,428,777 (GRCm39) D259G probably damaging Het
Atmin A G 8: 117,683,327 (GRCm39) D329G probably damaging Het
Ccdc121 A G 5: 31,644,954 (GRCm39) I236V probably benign Het
Cdkal1 A G 13: 30,034,007 (GRCm39) F29L probably benign Het
Chrng C T 1: 87,139,202 (GRCm39) P518S probably benign Het
Cpa1 G T 6: 30,641,847 (GRCm39) D224Y probably damaging Het
D6Ertd527e G C 6: 87,088,839 (GRCm39) S334T unknown Het
Dnm1 A T 2: 32,202,344 (GRCm39) S773T probably benign Het
Glmn A T 5: 107,706,368 (GRCm39) V419E possibly damaging Het
Il18rap T A 1: 40,586,990 (GRCm39) V424E probably benign Het
Kdm6b C A 11: 69,297,276 (GRCm39) G359* probably null Het
Krt84 A G 15: 101,438,016 (GRCm39) probably null Het
Lig4 C A 8: 10,022,325 (GRCm39) C485F probably damaging Het
Mpo T A 11: 87,690,794 (GRCm39) W411R probably damaging Het
Mpv17l A G 16: 13,759,149 (GRCm39) E8G probably benign Het
Mrps34 T C 17: 25,114,451 (GRCm39) Y104H probably benign Het
Muc15 T A 2: 110,562,007 (GRCm39) W148R probably damaging Het
Nrg1 T C 8: 32,439,995 (GRCm39) D134G probably benign Het
Prdm1 T C 10: 44,317,608 (GRCm39) Y405C probably damaging Het
Ptprb T C 10: 116,158,431 (GRCm39) S501P possibly damaging Het
Pwp1 C A 10: 85,723,958 (GRCm39) S486R possibly damaging Het
Rtl1 T C 12: 109,557,171 (GRCm39) E1556G probably damaging Het
Rtl1 T C 12: 109,561,698 (GRCm39) Q47R unknown Het
Siglece A G 7: 43,307,055 (GRCm39) F311L probably benign Het
Slc27a3 A G 3: 90,293,618 (GRCm39) L589P probably damaging Het
Spata31e2 A C 1: 26,721,232 (GRCm39) L1316* probably null Het
Synrg T A 11: 83,881,660 (GRCm39) M332K probably benign Het
Tasor2 T A 13: 3,623,559 (GRCm39) R2130S possibly damaging Het
Tecta T A 9: 42,270,759 (GRCm39) N1183I probably damaging Het
Tmed11 A G 5: 108,926,915 (GRCm39) I119T possibly damaging Het
Ttll3 C T 6: 113,389,834 (GRCm39) R740W probably damaging Het
Usp40 T C 1: 87,935,161 (GRCm39) probably benign Het
Vmn1r236 C T 17: 21,507,418 (GRCm39) H179Y probably benign Het
Wwtr1 T C 3: 57,384,825 (GRCm39) M298V possibly damaging Het
Xrcc4 T A 13: 90,089,118 (GRCm39) M280L probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGGCTGCTTTACACATC -3'
(R):5'- CCTAACCTGTGGATCATACCTTG -3'

Sequencing Primer
(F):5'- ACACATCCACTCCTTTGATTAGTG -3'
(R):5'- GTCTGAAGACAGCTACAGTGTACTC -3'
Posted On 2022-07-18