Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Usp40'

719720

Institutional Source

Beutler Lab

Gene Symbol

Usp40

Ensembl Gene

ENSMUSG00000005501

Gene Name

ubiquitin specific peptidase 40

Synonyms

B230215L03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001033291

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87945119-88008551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88007395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 10 (Y10C)

Ref Sequence

ENSEMBL: ENSMUSP00000140107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]

AlphaFold

Q8BWR4

Predicted Effect

probably benign
Transcript: ENSMUST00000040783
AA Change: Y10C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: Y10C

Domain	Start	End	E-Value	Type
Pfam:UCH	40	344	1.1e-31	PFAM
Pfam:UCH_1	41	320	1.2e-20	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187758
AA Change: Y10C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: Y10C

Domain	Start	End	E-Value	Type
Pfam:UCH	40	346	8.7e-41	PFAM
Pfam:UCH_1	41	319	2.4e-22	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188332
AA Change: Y10C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501
AA Change: Y10C

Domain	Start	End	E-Value	Type
Pfam:UCH	40	70	5.9e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Usp40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Usp40	APN	1	88004238	splice site	probably benign
IGL00828:Usp40	APN	1	87978306	unclassified	probably benign
IGL01090:Usp40	APN	1	87962465	missense	probably benign	0.01
IGL01123:Usp40	APN	1	87986123	missense	probably benign	0.01
IGL01401:Usp40	APN	1	87994198	missense	probably damaging	1.00
IGL02506:Usp40	APN	1	87982016	missense	probably damaging	0.98
IGL02580:Usp40	APN	1	87980966	splice site	probably null
IGL02625:Usp40	APN	1	87950017	missense	probably benign	0.19
IGL02811:Usp40	APN	1	87995736	missense	probably damaging	1.00
IGL02958:Usp40	APN	1	87978485	missense	probably damaging	0.99
Brink	UTSW	1	87981033	missense	probably benign	0.11
void	UTSW	1	87995713	nonsense	probably null
G5030:Usp40	UTSW	1	87994219	missense	probably damaging	1.00
R0019:Usp40	UTSW	1	87978411	missense	probably benign	0.00
R0282:Usp40	UTSW	1	87980958	splice site	probably benign
R0453:Usp40	UTSW	1	87946598	makesense	probably null
R0646:Usp40	UTSW	1	87978522	missense	probably benign	0.00
R1440:Usp40	UTSW	1	87982086	missense	probably benign	0.01
R1490:Usp40	UTSW	1	87988965	nonsense	probably null
R1620:Usp40	UTSW	1	87994225	missense	probably damaging	1.00
R1881:Usp40	UTSW	1	87994271	missense	probably benign	0.08
R1903:Usp40	UTSW	1	87982056	missense	probably benign	0.15
R1912:Usp40	UTSW	1	87946646	missense	probably benign	0.00
R1919:Usp40	UTSW	1	87995842	missense	possibly damaging	0.75
R1976:Usp40	UTSW	1	87978536	missense	probably benign	0.00
R2111:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2112:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2163:Usp40	UTSW	1	87995858	splice site	probably benign
R2432:Usp40	UTSW	1	87982082	missense	probably benign
R2865:Usp40	UTSW	1	87949979	nonsense	probably null
R3885:Usp40	UTSW	1	87967269	missense	probably damaging	1.00
R4360:Usp40	UTSW	1	87952361	missense	probably damaging	1.00
R4370:Usp40	UTSW	1	87997875	missense	probably benign
R4496:Usp40	UTSW	1	87995737	missense	possibly damaging	0.69
R4714:Usp40	UTSW	1	87967179	splice site	probably null
R4888:Usp40	UTSW	1	87986201	critical splice acceptor site	probably null
R4944:Usp40	UTSW	1	87952355	missense	probably benign	0.10
R5269:Usp40	UTSW	1	87995782	missense	probably benign	0.01
R5629:Usp40	UTSW	1	87981009	missense	probably benign
R5696:Usp40	UTSW	1	87995752	missense	probably benign	0.27
R5756:Usp40	UTSW	1	87951691	missense	possibly damaging	0.66
R5887:Usp40	UTSW	1	87999870	missense	probably damaging	1.00
R5910:Usp40	UTSW	1	87968400	nonsense	probably null
R6014:Usp40	UTSW	1	87980016	missense	probably damaging	1.00
R6044:Usp40	UTSW	1	87990150	missense	probably benign
R6083:Usp40	UTSW	1	87978559	missense	probably benign	0.01
R6299:Usp40	UTSW	1	87997927	missense	probably damaging	0.99
R6625:Usp40	UTSW	1	87967213	missense	probably benign	0.01
R6757:Usp40	UTSW	1	87980037	missense	probably damaging	0.99
R6810:Usp40	UTSW	1	87981033	missense	probably benign	0.11
R7110:Usp40	UTSW	1	87986162	missense	probably benign	0.11
R7573:Usp40	UTSW	1	87986072	missense	probably benign	0.09
R7575:Usp40	UTSW	1	87949960	missense	probably damaging	1.00
R7634:Usp40	UTSW	1	87962430	nonsense	probably null
R7756:Usp40	UTSW	1	87967200	missense	probably damaging	0.99
R7767:Usp40	UTSW	1	87982178	missense	probably benign	0.01
R7861:Usp40	UTSW	1	87982130	missense	probably damaging	0.99
R7881:Usp40	UTSW	1	87995713	nonsense	probably null
R7896:Usp40	UTSW	1	87978479	missense	possibly damaging	0.77
R8119:Usp40	UTSW	1	87967678	splice site	probably null
R8354:Usp40	UTSW	1	87980972	missense	probably benign	0.00
R8358:Usp40	UTSW	1	87981048	missense	possibly damaging	0.71
R8425:Usp40	UTSW	1	87959836	missense	probably benign
R8446:Usp40	UTSW	1	87978468	missense	probably benign
R8454:Usp40	UTSW	1	87980972	missense	probably benign	0.00
R8744:Usp40	UTSW	1	87983769	missense	probably benign
R9002:Usp40	UTSW	1	88007341	missense	probably benign
R9033:Usp40	UTSW	1	87995777	utr 3 prime	probably benign
R9210:Usp40	UTSW	1	87957313	missense	possibly damaging	0.90
R9245:Usp40	UTSW	1	87950287	missense	probably benign
R9331:Usp40	UTSW	1	87974106	missense	probably damaging	1.00
R9378:Usp40	UTSW	1	87957310	missense	probably damaging	1.00
R9379:Usp40	UTSW	1	87954167	missense	probably benign
R9501:Usp40	UTSW	1	87997835	missense	probably benign	0.01
R9535:Usp40	UTSW	1	88007439	start gained	probably benign
RF006:Usp40	UTSW	1	87967195	missense	possibly damaging	0.47
Z1177:Usp40	UTSW	1	87968414	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCTCTGAATTCAGGTGTGAAATG -3'
(R):5'- AATCAGGACCCCGTGTAGGTAG -3'

Sequencing Primer
(F):5'- TTCAGGTGTGAAATGAAGCGTC -3'
(R):5'- GAAAGACAAGTCAGGTCTCGCTTTC -3'

Posted On

2022-07-18