Incidental Mutation 'R9537:Golga2'
ID 719722
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Name golgi autoantigen, golgin subfamily a, 2
Synonyms GM130
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 32287384-32307921 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 32288301 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050410] [ENSMUST00000081670] [ENSMUST00000100194] [ENSMUST00000113377] [ENSMUST00000113397] [ENSMUST00000113400] [ENSMUST00000129193] [ENSMUST00000139494] [ENSMUST00000140406] [ENSMUST00000183946]
AlphaFold Q921M4
Predicted Effect probably benign
Transcript: ENSMUST00000050410
SMART Domains Protein: ENSMUSP00000057512
Gene: ENSMUSG00000044627

DomainStartEndE-ValueType
Pfam:Swi5 9 89 7.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081670
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100194
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113377
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113397
SMART Domains Protein: ENSMUSP00000109024
Gene: ENSMUSG00000044627

DomainStartEndE-ValueType
Pfam:Swi5 1 59 9.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113400
SMART Domains Protein: ENSMUSP00000109027
Gene: ENSMUSG00000044627

DomainStartEndE-ValueType
Pfam:Swi5 45 120 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129193
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131712
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139494
SMART Domains Protein: ENSMUSP00000117476
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 55 61 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140406
SMART Domains Protein: ENSMUSP00000139369
Gene: ENSMUSG00000044627

DomainStartEndE-ValueType
Pfam:Swi5 47 120 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147707
SMART Domains Protein: ENSMUSP00000121886
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
coiled coil region 165 205 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183946
SMART Domains Protein: ENSMUSP00000139299
Gene: ENSMUSG00000044627

DomainStartEndE-ValueType
Pfam:Swi5 9 89 7.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
little UTSW 2 32305984 nonsense probably null
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 splice site probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1702:Golga2 UTSW 2 32299275 missense probably damaging 1.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1777:Golga2 UTSW 2 32305470 splice site probably null
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4783:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5103:Golga2 UTSW 2 32303746 missense probably benign 0.09
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R5921:Golga2 UTSW 2 32297755 missense probably benign 0.00
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
R7365:Golga2 UTSW 2 32303001 nonsense probably null
R7390:Golga2 UTSW 2 32288190 missense
R7395:Golga2 UTSW 2 32305587 missense possibly damaging 0.94
R7555:Golga2 UTSW 2 32288166 missense probably benign 0.07
R7640:Golga2 UTSW 2 32306239 missense probably benign
R8219:Golga2 UTSW 2 32306480 missense probably damaging 1.00
R8554:Golga2 UTSW 2 32293345 missense probably damaging 1.00
R9071:Golga2 UTSW 2 32288352 missense probably damaging 1.00
R9127:Golga2 UTSW 2 32306067 missense
R9214:Golga2 UTSW 2 32305810 missense probably damaging 1.00
R9643:Golga2 UTSW 2 32303862 missense probably damaging 0.97
R9716:Golga2 UTSW 2 32299275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTCTCGTCGTTAACTC -3'
(R):5'- GCTGAGAAGACTTCACTGGG -3'

Sequencing Primer
(F):5'- GTCGTTAACTCCACCCGTCG -3'
(R):5'- CGTGTGTCTCGGGAAAGACTC -3'
Posted On 2022-07-18