Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Ptgs1'

719723

Institutional Source

Beutler Lab

Gene Symbol

Ptgs1

Ensembl Gene

ENSMUSG00000047250

Gene Name

prostaglandin-endoperoxide synthase 1

Synonyms

Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.433) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36230426-36252272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36230727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 23 (S23P)

Ref Sequence

ENSEMBL: ENSMUSP00000059977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062069]

AlphaFold

P22437

Predicted Effect

unknown
Transcript: ENSMUST00000062069
AA Change: S23P

SMART Domains

Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: S23P

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
EGF	37	72	2.48e1	SMART
low complexity region	172	185	N/A	INTRINSIC
low complexity region	200	214	N/A	INTRINSIC
Pfam:An_peroxidase	221	528	1.5e-46	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Ptgs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Ptgs1	APN	2	36237219	missense	probably damaging	1.00
IGL02345:Ptgs1	APN	2	36242971	missense	probably null	0.93
IGL02952:Ptgs1	APN	2	36251241	missense	probably benign	0.00
IGL03306:Ptgs1	APN	2	36237705	missense	probably damaging	1.00
PIT4431001:Ptgs1	UTSW	2	36240680	missense	probably damaging	1.00
R0468:Ptgs1	UTSW	2	36249193	missense	probably damaging	1.00
R0638:Ptgs1	UTSW	2	36240856	splice site	probably benign
R1563:Ptgs1	UTSW	2	36245202	missense	possibly damaging	0.53
R1858:Ptgs1	UTSW	2	36242770	missense	probably benign	0.19
R2012:Ptgs1	UTSW	2	36237656	missense	probably benign
R2080:Ptgs1	UTSW	2	36242847	nonsense	probably null
R2116:Ptgs1	UTSW	2	36237696	nonsense	probably null
R4073:Ptgs1	UTSW	2	36237776	missense	probably damaging	1.00
R4163:Ptgs1	UTSW	2	36251334	missense	possibly damaging	0.87
R4862:Ptgs1	UTSW	2	36237255	missense	probably damaging	1.00
R5062:Ptgs1	UTSW	2	36237282	missense	probably damaging	1.00
R5071:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5072:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5073:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5074:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5373:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5374:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5419:Ptgs1	UTSW	2	36237222	missense	probably damaging	1.00
R5428:Ptgs1	UTSW	2	36245268	missense	probably benign	0.00
R5918:Ptgs1	UTSW	2	36251077	missense	probably damaging	1.00
R6134:Ptgs1	UTSW	2	36251178	missense	probably damaging	1.00
R6181:Ptgs1	UTSW	2	36251119	missense	probably damaging	1.00
R6240:Ptgs1	UTSW	2	36237285	missense	probably damaging	1.00
R6979:Ptgs1	UTSW	2	36251299	missense	probably benign
R7020:Ptgs1	UTSW	2	36251029	missense	probably damaging	1.00
R7445:Ptgs1	UTSW	2	36245210	missense	probably benign	0.06
R7557:Ptgs1	UTSW	2	36245211	missense	possibly damaging	0.92
R7873:Ptgs1	UTSW	2	36251280	missense	probably damaging	1.00
R8215:Ptgs1	UTSW	2	36251167	missense	probably damaging	1.00
R9244:Ptgs1	UTSW	2	36240712	missense	probably damaging	0.96
R9709:Ptgs1	UTSW	2	36251192	missense	probably damaging	1.00
Z1176:Ptgs1	UTSW	2	36240776	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGTCATGAGTCGTGAGTCC -3'
(R):5'- AAAGAACCTGTCTCTGCTTCC -3'

Sequencing Primer
(F):5'- ATGAGTCGTGAGTCCGACCC -3'
(R):5'- TGTGTGCCAGAGAGATCCCAG -3'

Posted On

2022-07-18