Incidental Mutation 'R9537:Ptgs1'
ID 719723
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Name prostaglandin-endoperoxide synthase 1
Synonyms Pghs1, Cox-1, COX1, cyclooxygenase 1, Cox-3
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36120438-36142284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36120739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
AlphaFold P22437
Predicted Effect unknown
Transcript: ENSMUST00000062069
AA Change: S23P
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,118,207 (GRCm39) Y1114H possibly damaging Het
Atp5pf A G 16: 84,625,358 (GRCm39) Y82H probably damaging Het
Bcl2a1d T G 9: 88,613,526 (GRCm39) I83L probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bglap3 T C 3: 88,276,139 (GRCm39) D71G probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Chmp2b T C 16: 65,347,932 (GRCm39) K15E probably benign Het
Chrm3 A T 13: 9,927,462 (GRCm39) W525R probably damaging Het
Col7a1 A T 9: 108,784,420 (GRCm39) K143* probably null Het
D6Ertd527e G C 6: 87,088,839 (GRCm39) S334T unknown Het
Dnai1 A G 4: 41,629,790 (GRCm39) probably null Het
Dnhd1 G A 7: 105,344,740 (GRCm39) G2028D probably damaging Het
Esyt3 C T 9: 99,199,292 (GRCm39) R773Q probably damaging Het
Ffar1 T C 7: 30,560,025 (GRCm39) T291A probably benign Het
Golga2 G T 2: 32,178,313 (GRCm39) probably benign Het
Hapln2 T A 3: 87,931,780 (GRCm39) probably null Het
Ing1 T C 8: 11,611,889 (GRCm39) L203P probably benign Het
Litafd G T 16: 8,501,177 (GRCm39) C11F Het
Mab21l4 T C 1: 93,080,884 (GRCm39) K341E possibly damaging Het
Med1 T C 11: 98,062,586 (GRCm39) T171A possibly damaging Het
Mib2 A T 4: 155,741,952 (GRCm39) L387H probably damaging Het
Mier1 A G 4: 103,019,758 (GRCm39) N494S probably benign Het
Myof A G 19: 37,896,054 (GRCm39) L1847P probably damaging Het
Ndst3 A T 3: 123,465,162 (GRCm39) V270D Het
Nup160 T C 2: 90,560,088 (GRCm39) L1271S possibly damaging Het
Osgep A T 14: 51,162,119 (GRCm39) probably null Het
Ptgfr G T 3: 151,541,445 (GRCm39) T21N possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Smu1 A G 4: 40,755,671 (GRCm39) S65P probably benign Het
Spef2 T C 15: 9,601,885 (GRCm39) Y1459C unknown Het
Spen A G 4: 141,199,015 (GRCm39) V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,244,156 (GRCm39) probably benign Het
Timm44 G A 8: 4,310,576 (GRCm39) T392I possibly damaging Het
Tnc A T 4: 63,884,821 (GRCm39) I1818N probably damaging Het
Trpm1 G T 7: 63,803,616 (GRCm39) probably benign Het
Ttc14 A G 3: 33,857,347 (GRCm39) Y231C probably damaging Het
Ube3b A G 5: 114,525,245 (GRCm39) R23G probably damaging Het
Usp40 T C 1: 87,935,117 (GRCm39) Y10C probably benign Het
Vmn2r107 C A 17: 20,595,149 (GRCm39) S567R probably benign Het
Zfp112 T C 7: 23,826,512 (GRCm39) Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 (GRCm39) T355S Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36,127,231 (GRCm39) missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36,132,983 (GRCm39) missense probably null 0.93
IGL02952:Ptgs1 APN 2 36,141,253 (GRCm39) missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36,127,717 (GRCm39) missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36,130,692 (GRCm39) missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36,139,205 (GRCm39) missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36,130,868 (GRCm39) splice site probably benign
R1563:Ptgs1 UTSW 2 36,135,214 (GRCm39) missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36,132,782 (GRCm39) missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36,127,668 (GRCm39) missense probably benign
R2080:Ptgs1 UTSW 2 36,132,859 (GRCm39) nonsense probably null
R2116:Ptgs1 UTSW 2 36,127,708 (GRCm39) nonsense probably null
R4073:Ptgs1 UTSW 2 36,127,788 (GRCm39) missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36,141,346 (GRCm39) missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36,127,267 (GRCm39) missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36,127,294 (GRCm39) missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36,141,198 (GRCm39) missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36,141,198 (GRCm39) missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36,127,234 (GRCm39) missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36,135,280 (GRCm39) missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36,141,089 (GRCm39) missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36,141,190 (GRCm39) missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36,141,131 (GRCm39) missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36,127,297 (GRCm39) missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36,141,311 (GRCm39) missense probably benign
R7020:Ptgs1 UTSW 2 36,141,041 (GRCm39) missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36,135,222 (GRCm39) missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36,135,223 (GRCm39) missense possibly damaging 0.92
R7873:Ptgs1 UTSW 2 36,141,292 (GRCm39) missense probably damaging 1.00
R8215:Ptgs1 UTSW 2 36,141,179 (GRCm39) missense probably damaging 1.00
R9244:Ptgs1 UTSW 2 36,130,724 (GRCm39) missense probably damaging 0.96
R9709:Ptgs1 UTSW 2 36,141,204 (GRCm39) missense probably damaging 1.00
Z1176:Ptgs1 UTSW 2 36,130,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGTCATGAGTCGTGAGTCC -3'
(R):5'- AAAGAACCTGTCTCTGCTTCC -3'

Sequencing Primer
(F):5'- ATGAGTCGTGAGTCCGACCC -3'
(R):5'- TGTGTGCCAGAGAGATCCCAG -3'
Posted On 2022-07-18