Incidental Mutation 'R9537:Ptgs1'
ID 719723
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Name prostaglandin-endoperoxide synthase 1
Synonyms Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36230426-36252272 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36230727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
AlphaFold P22437
Predicted Effect unknown
Transcript: ENSMUST00000062069
AA Change: S23P
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: S23P

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36237219 missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36242971 missense probably null 0.93
IGL02952:Ptgs1 APN 2 36251241 missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36237705 missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36240680 missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36249193 missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36240856 splice site probably benign
R1563:Ptgs1 UTSW 2 36245202 missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36242770 missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36237656 missense probably benign
R2080:Ptgs1 UTSW 2 36242847 nonsense probably null
R2116:Ptgs1 UTSW 2 36237696 nonsense probably null
R4073:Ptgs1 UTSW 2 36237776 missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36251334 missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36237255 missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36237282 missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36237222 missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36245268 missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36251077 missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36251178 missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36251119 missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36237285 missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36251299 missense probably benign
R7020:Ptgs1 UTSW 2 36251029 missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36245210 missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36245211 missense possibly damaging 0.92
R7873:Ptgs1 UTSW 2 36251280 missense probably damaging 1.00
R8215:Ptgs1 UTSW 2 36251167 missense probably damaging 1.00
R9244:Ptgs1 UTSW 2 36240712 missense probably damaging 0.96
R9709:Ptgs1 UTSW 2 36251192 missense probably damaging 1.00
Z1176:Ptgs1 UTSW 2 36240776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGTCATGAGTCGTGAGTCC -3'
(R):5'- AAAGAACCTGTCTCTGCTTCC -3'

Sequencing Primer
(F):5'- ATGAGTCGTGAGTCCGACCC -3'
(R):5'- TGTGTGCCAGAGAGATCCCAG -3'
Posted On 2022-07-18