Incidental Mutation 'R9537:Ttc14'
ID 719725
Institutional Source Beutler Lab
Gene Symbol Ttc14
Ensembl Gene ENSMUSG00000027677
Gene Name tetratricopeptide repeat domain 14
Synonyms cI-44, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik, 4933402I15Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 33799832-33814860 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33803198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 231 (Y231C)
Ref Sequence ENSEMBL: ENSMUSP00000096757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000196139] [ENSMUST00000196369] [ENSMUST00000196975] [ENSMUST00000198529] [ENSMUST00000199222] [ENSMUST00000200271]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099153
AA Change: Y231C

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108210
AA Change: Y231C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117915
AA Change: Y231C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196139
SMART Domains Protein: ENSMUSP00000143173
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
SCOP:d1go3e_ 144 217 3e-5 SMART
Blast:S1 154 217 2e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196369
AA Change: Y129C

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142863
Gene: ENSMUSG00000027677
AA Change: Y129C

DomainStartEndE-ValueType
S1 21 105 7.28e-2 SMART
TPR 204 237 6.19e-1 SMART
TPR 238 271 2.11e-3 SMART
TPR 279 312 1.88e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196975
AA Change: Y231C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142684
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 4.6e-4 SMART
TPR 254 287 3e-3 SMART
TPR 288 321 1e-5 SMART
TPR 329 362 9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198529
AA Change: Y231C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143073
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
Pfam:TPR_11 304 371 2.1e-12 PFAM
Pfam:TPR_2 306 339 1.9e-4 PFAM
Pfam:TPR_1 308 339 1.3e-4 PFAM
Pfam:TPR_1 340 373 2.9e-5 PFAM
Pfam:TPR_2 340 373 6.8e-4 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199222
AA Change: Y231C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677
AA Change: Y231C

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200271
AA Change: Y228C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143738
Gene: ENSMUSG00000027677
AA Change: Y228C

DomainStartEndE-ValueType
S1 120 204 7.28e-2 SMART
TPR 303 336 6.19e-1 SMART
TPR 337 370 2.11e-3 SMART
TPR 378 411 1.88e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Ttc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ttc14 APN 3 33803099 missense probably benign 0.35
IGL01326:Ttc14 APN 3 33801358 missense probably benign 0.14
R0196:Ttc14 UTSW 3 33809254 unclassified probably benign
R0427:Ttc14 UTSW 3 33803484 missense probably damaging 1.00
R1713:Ttc14 UTSW 3 33802920 missense probably damaging 1.00
R2312:Ttc14 UTSW 3 33807835 splice site probably null
R2434:Ttc14 UTSW 3 33801078 missense probably benign 0.40
R4794:Ttc14 UTSW 3 33803149 missense probably benign 0.00
R4825:Ttc14 UTSW 3 33801369 missense possibly damaging 0.88
R4888:Ttc14 UTSW 3 33806875 nonsense probably null
R5143:Ttc14 UTSW 3 33808901 unclassified probably benign
R6051:Ttc14 UTSW 3 33808924 unclassified probably benign
R6270:Ttc14 UTSW 3 33800388 missense possibly damaging 0.68
R6415:Ttc14 UTSW 3 33803575 missense possibly damaging 0.81
R6439:Ttc14 UTSW 3 33808819 unclassified probably benign
R7021:Ttc14 UTSW 3 33803497 missense probably damaging 0.99
R7571:Ttc14 UTSW 3 33809251 missense unknown
R7751:Ttc14 UTSW 3 33809441 missense unknown
R8021:Ttc14 UTSW 3 33809121 nonsense probably null
R8388:Ttc14 UTSW 3 33800586 missense probably benign 0.01
R8884:Ttc14 UTSW 3 33800547 missense unknown
R9169:Ttc14 UTSW 3 33802922 nonsense probably null
R9399:Ttc14 UTSW 3 33804707 missense possibly damaging 0.62
R9438:Ttc14 UTSW 3 33804712 missense probably damaging 1.00
R9663:Ttc14 UTSW 3 33801388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCGAGGTGATCAACTTCAACATAC -3'
(R):5'- CCCGACTTTACTAGAAATGTGACTC -3'

Sequencing Primer
(F):5'- CTTCAAAGCTGGAATCAAGG -3'
(R):5'- CTCTAGGAGGGTTAAACACTAATGCC -3'
Posted On 2022-07-18