Incidental Mutation 'R9537:Hapln2'
ID 719726
Institutional Source Beutler Lab
Gene Symbol Hapln2
Ensembl Gene ENSMUSG00000004894
Gene Name hyaluronan and proteoglycan link protein 2
Synonyms 4930401E20Rik, Bral1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 88021750-88027583 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 88024473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005014] [ENSMUST00000005014] [ENSMUST00000005014] [ENSMUST00000005014] [ENSMUST00000160150]
AlphaFold Q9ESM3
Predicted Effect probably null
Transcript: ENSMUST00000005014
SMART Domains Protein: ENSMUSP00000005014
Gene: ENSMUSG00000004894

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 53 131 1.43e-8 SMART
LINK 147 243 4.25e-44 SMART
LINK 247 339 9.41e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000005014
SMART Domains Protein: ENSMUSP00000005014
Gene: ENSMUSG00000004894

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 53 131 1.43e-8 SMART
LINK 147 243 4.25e-44 SMART
LINK 247 339 9.41e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000005014
SMART Domains Protein: ENSMUSP00000005014
Gene: ENSMUSG00000004894

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 53 131 1.43e-8 SMART
LINK 147 243 4.25e-44 SMART
LINK 247 339 9.41e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000005014
SMART Domains Protein: ENSMUSP00000005014
Gene: ENSMUSG00000004894

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 53 131 1.43e-8 SMART
LINK 147 243 4.25e-44 SMART
LINK 247 339 9.41e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160150
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display reduced nerve conduction velocity and abnormalities in the neuronal extracellular matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Hapln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hapln2 APN 3 88024334 missense possibly damaging 0.82
IGL01644:Hapln2 APN 3 88022637 missense probably damaging 0.99
IGL03177:Hapln2 APN 3 88022771 missense probably damaging 1.00
R0349:Hapln2 UTSW 3 88023629 missense probably damaging 1.00
R1546:Hapln2 UTSW 3 88024097 missense probably benign 0.01
R1791:Hapln2 UTSW 3 88024405 missense possibly damaging 0.66
R1842:Hapln2 UTSW 3 88024001 missense probably damaging 1.00
R1922:Hapln2 UTSW 3 88023377 missense probably benign 0.22
R1970:Hapln2 UTSW 3 88024120 critical splice acceptor site probably null
R2152:Hapln2 UTSW 3 88023613 missense probably benign 0.21
R5017:Hapln2 UTSW 3 88024001 missense probably damaging 1.00
R6190:Hapln2 UTSW 3 88023293 missense probably damaging 1.00
R6852:Hapln2 UTSW 3 88022651 missense possibly damaging 0.61
R6910:Hapln2 UTSW 3 88023828 missense probably damaging 1.00
R7585:Hapln2 UTSW 3 88022673 missense probably damaging 1.00
R8270:Hapln2 UTSW 3 88023544 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGGGACTTTCAACAGCTGCC -3'
(R):5'- ATTCCAATGGAAGGCCTGGG -3'

Sequencing Primer
(F):5'- GGTCCCCTACCCCAGTGTTC -3'
(R):5'- AGGCCTGGGGAGTAGCTG -3'
Posted On 2022-07-18