Incidental Mutation 'R9537:Bglap3'
ID 719727
Institutional Source Beutler Lab
Gene Symbol Bglap3
Ensembl Gene ENSMUSG00000074489
Gene Name bone gamma-carboxyglutamate protein 3
Synonyms ORG, Bglap-rs1, mOC-X
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 88368616-88372743 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88368832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 71 (D71G)
Ref Sequence ENSEMBL: ENSMUSP00000074965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075523] [ENSMUST00000107542] [ENSMUST00000107543] [ENSMUST00000147948] [ENSMUST00000147991]
AlphaFold P54615
Predicted Effect probably benign
Transcript: ENSMUST00000075523
AA Change: D71G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074965
Gene: ENSMUSG00000074489
AA Change: D71G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107542
AA Change: D71G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103166
Gene: ENSMUSG00000074489
AA Change: D71G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107543
AA Change: D71G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103167
Gene: ENSMUSG00000074489
AA Change: D71G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147948
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147991
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Bglap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Bglap3 APN 3 88369116 missense possibly damaging 0.90
IGL02984:Bglap3 UTSW 3 88368791 missense possibly damaging 0.66
R0496:Bglap3 UTSW 3 88369137 missense probably damaging 0.98
R1435:Bglap3 UTSW 3 88369146 missense possibly damaging 0.70
R1903:Bglap3 UTSW 3 88368761 missense probably benign 0.01
R1970:Bglap3 UTSW 3 88376993 unclassified probably benign
R2296:Bglap3 UTSW 3 88369512 unclassified probably benign
R2326:Bglap3 UTSW 3 88369512 unclassified probably benign
R2917:Bglap3 UTSW 3 88369512 unclassified probably benign
R4967:Bglap3 UTSW 3 88376364 unclassified probably benign
R5941:Bglap3 UTSW 3 88376346 unclassified probably benign
R6259:Bglap3 UTSW 3 88368760 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTGACATCCATACTTGCAG -3'
(R):5'- TTCTGGGGTAGTCTCTATGACCC -3'

Sequencing Primer
(F):5'- TGACATCCATACTTGCAGGGCAG -3'
(R):5'- TAGTCTCTATGACCCGCAGAG -3'
Posted On 2022-07-18