Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Ndst3'

719728

Institutional Source

Beutler Lab

Gene Symbol

Ndst3

Ensembl Gene

ENSMUSG00000027977

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3

Synonyms

4930511P15Rik, 4921531K01Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123526166-123690853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123671513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 270 (V270D)

Ref Sequence

ENSEMBL: ENSMUSP00000029602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: V270D

Domain	Start	End	E-Value	Type
Pfam:HSNSD	19	506	4.6e-272	PFAM
Pfam:Sulfotransfer_1	595	858	8.4e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000137404
AA Change: V270D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: V270D

Domain	Start	End	E-Value	Type
Pfam:HSNSD	19	506	6.4e-272	PFAM
PDB:1NST\|A	549	637	2e-38	PDB
SCOP:d1nsta_	570	641	9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154668
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: V270D

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	506	1.7e-253	PFAM
Pfam:Sulfotransfer_1	595	858	8.4e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172537
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: V270D

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	328	2.4e-130	PFAM
Pfam:HSNSD	326	425	8.2e-62	PFAM
PDB:1NST\|A	468	556	7e-39	PDB
SCOP:d1nsta_	489	560	5e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Ndst3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Ndst3	APN	3	123627950	splice site	probably benign
IGL00543:Ndst3	APN	3	123672263	missense	probably damaging	0.99
IGL01067:Ndst3	APN	3	123546817	missense	probably damaging	1.00
IGL01301:Ndst3	APN	3	123548916	missense	probably damaging	0.97
IGL01975:Ndst3	APN	3	123601514	missense	possibly damaging	0.67
IGL02376:Ndst3	APN	3	123556798	missense	probably damaging	0.98
IGL02715:Ndst3	APN	3	123546761	splice site	probably benign
IGL03111:Ndst3	APN	3	123672096	missense	possibly damaging	0.96
Jack_sprat	UTSW	3	123552552	missense	probably damaging	0.99
ANU18:Ndst3	UTSW	3	123548916	missense	probably damaging	0.97
R0027:Ndst3	UTSW	3	123671513	missense	probably damaging	1.00
R0288:Ndst3	UTSW	3	123672194	missense	probably benign	0.03
R0630:Ndst3	UTSW	3	123562071	missense	probably damaging	0.98
R1168:Ndst3	UTSW	3	123606968	missense	probably benign	0.22
R1400:Ndst3	UTSW	3	123556828	missense	probably damaging	1.00
R1513:Ndst3	UTSW	3	123601455	missense	possibly damaging	0.75
R1524:Ndst3	UTSW	3	123548906	missense	possibly damaging	0.94
R1830:Ndst3	UTSW	3	123548938	missense	probably damaging	0.96
R1831:Ndst3	UTSW	3	123601478	missense	probably benign
R1865:Ndst3	UTSW	3	123671471	missense	probably damaging	1.00
R1871:Ndst3	UTSW	3	123562024	missense	probably damaging	1.00
R2041:Ndst3	UTSW	3	123672215	missense	probably benign	0.01
R2056:Ndst3	UTSW	3	123671885	missense	probably damaging	0.98
R2362:Ndst3	UTSW	3	123552678	missense	possibly damaging	0.94
R2484:Ndst3	UTSW	3	123552537	missense	possibly damaging	0.83
R3747:Ndst3	UTSW	3	123671552	missense	probably benign	0.09
R4152:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4153:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4154:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4512:Ndst3	UTSW	3	123671666	missense	probably damaging	1.00
R4579:Ndst3	UTSW	3	123546825	missense	probably benign	0.00
R4611:Ndst3	UTSW	3	123671549	missense	probably benign	0.35
R4646:Ndst3	UTSW	3	123672035	missense	probably damaging	0.96
R4718:Ndst3	UTSW	3	123672266	missense	probably benign	0.35
R4944:Ndst3	UTSW	3	123607027	missense	probably damaging	0.99
R4945:Ndst3	UTSW	3	123552552	missense	probably damaging	1.00
R5179:Ndst3	UTSW	3	123552532	missense	probably damaging	0.97
R5232:Ndst3	UTSW	3	123672239	missense	probably damaging	0.99
R5421:Ndst3	UTSW	3	123634359	splice site	probably null
R5874:Ndst3	UTSW	3	123561907	missense	probably damaging	1.00
R6030:Ndst3	UTSW	3	123552519	missense	probably damaging	1.00
R6030:Ndst3	UTSW	3	123552519	missense	probably damaging	1.00
R6228:Ndst3	UTSW	3	123671652	nonsense	probably null
R6496:Ndst3	UTSW	3	123552552	missense	probably damaging	0.99
R6562:Ndst3	UTSW	3	123552532	missense	probably damaging	0.97
R7045:Ndst3	UTSW	3	123672083	missense	probably damaging	0.96
R7152:Ndst3	UTSW	3	123552656	missense	possibly damaging	0.66
R7202:Ndst3	UTSW	3	123671739	missense	possibly damaging	0.94
R7239:Ndst3	UTSW	3	123606906	missense	probably damaging	1.00
R7305:Ndst3	UTSW	3	123601482	missense	possibly damaging	0.62
R7417:Ndst3	UTSW	3	123671664	missense	probably damaging	1.00
R7469:Ndst3	UTSW	3	123671661	missense	possibly damaging	0.82
R7553:Ndst3	UTSW	3	123557060	splice site	probably null
R7955:Ndst3	UTSW	3	123606937	missense	probably benign	0.01
R8065:Ndst3	UTSW	3	123601445	missense	probably damaging	1.00
R8067:Ndst3	UTSW	3	123601445	missense	probably damaging	1.00
R8363:Ndst3	UTSW	3	123556868	missense	possibly damaging	0.83
R8708:Ndst3	UTSW	3	123528915	missense	probably benign	0.01
R8752:Ndst3	UTSW	3	123549035	missense	probably damaging	1.00
R9051:Ndst3	UTSW	3	123671900	missense	probably benign	0.00
R9428:Ndst3	UTSW	3	123546869	missense	probably benign	0.00
R9511:Ndst3	UTSW	3	123606906	missense	probably damaging	1.00
R9662:Ndst3	UTSW	3	123671466	missense	probably benign	0.01
R9667:Ndst3	UTSW	3	123560217	missense	possibly damaging	0.67
R9747:Ndst3	UTSW	3	123546812	missense	possibly damaging	0.84
R9748:Ndst3	UTSW	3	123627982	missense	probably benign	0.17
Z1176:Ndst3	UTSW	3	123552630	missense	probably damaging	1.00
Z1176:Ndst3	UTSW	3	123627969	missense	possibly damaging	0.49
Z1176:Ndst3	UTSW	3	123671494	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCACCAACTGAGGAAATCTAAG -3'
(R):5'- TCCAAGCTGGACAGAGGTTC -3'

Sequencing Primer
(F):5'- AGAGCCTTACCTTCACATCATTGGTG -3'
(R):5'- CAAGCTGGACAGAGGTTCTCTAC -3'

Posted On

2022-07-18