Incidental Mutation 'R9537:Smu1'
ID 719730
Institutional Source Beutler Lab
Gene Symbol Smu1
Ensembl Gene ENSMUSG00000028409
Gene Name smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms 2610203K23Rik, 2600001O03Rik, SMU-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 40736542-40757923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40755671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000030117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117]
AlphaFold Q3UKJ7
Predicted Effect probably benign
Transcript: ENSMUST00000030117
AA Change: S65P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409
AA Change: S65P

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Smu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Smu1 APN 4 40739550 missense probably damaging 0.97
IGL03271:Smu1 APN 4 40738408 missense probably benign 0.11
IGL03329:Smu1 APN 4 40739568 missense possibly damaging 0.81
PIT4585001:Smu1 UTSW 4 40739623 missense probably benign
R0172:Smu1 UTSW 4 40738439 missense probably benign 0.00
R1109:Smu1 UTSW 4 40755722 missense probably benign 0.12
R1552:Smu1 UTSW 4 40748570 missense probably damaging 1.00
R1799:Smu1 UTSW 4 40745537 missense probably damaging 1.00
R2093:Smu1 UTSW 4 40738438 missense probably benign 0.12
R2143:Smu1 UTSW 4 40744073 missense probably damaging 0.99
R3082:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3083:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3113:Smu1 UTSW 4 40748658 missense probably benign 0.03
R3157:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3158:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3159:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3409:Smu1 UTSW 4 40752008 missense probably benign
R3411:Smu1 UTSW 4 40752008 missense probably benign
R4581:Smu1 UTSW 4 40737401 splice site probably null
R5106:Smu1 UTSW 4 40743104 missense possibly damaging 0.82
R7747:Smu1 UTSW 4 40748600 missense probably benign 0.44
R9029:Smu1 UTSW 4 40738361 missense probably damaging 1.00
R9069:Smu1 UTSW 4 40745558 missense probably damaging 1.00
R9797:Smu1 UTSW 4 40739538 missense possibly damaging 0.69
Predicted Primers
Posted On 2022-07-18