Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Dnaic1'

719731

Institutional Source

Beutler Lab

Gene Symbol

Dnaic1

Ensembl Gene

ENSMUSG00000061322

Gene Name

dynein, axonemal, intermediate chain 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.600) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41569775-41638158 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 41629790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000100028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102963] [ENSMUST00000119127]

AlphaFold

Q8C0M8

Predicted Effect

probably null
Transcript: ENSMUST00000102963

SMART Domains

Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322

Domain	Start	End	E-Value	Type
low complexity region	134	158	N/A	INTRINSIC
low complexity region	238	261	N/A	INTRINSIC
Blast:WD40	319	370	1e-17	BLAST
WD40	374	413	1.5e-3	SMART
WD40	419	465	4.4e-2	SMART
Blast:WD40	493	526	5e-13	BLAST
WD40	530	570	9.3e-9	SMART
WD40	575	612	6e-3	SMART
WD40	623	659	1.4e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119127

SMART Domains

Protein: ENSMUSP00000113929
Gene: ENSMUSG00000061322

Domain	Start	End	E-Value	Type
Blast:WD40	16	53	2e-19	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Dnaic1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02678:Dnaic1	APN	4	41602917	missense	probably benign	0.03
IGL02825:Dnaic1	APN	4	41625101	splice site	probably benign
IGL03072:Dnaic1	APN	4	41602979	missense	probably benign	0.00
H8562:Dnaic1	UTSW	4	41629833	missense	possibly damaging	0.81
R0114:Dnaic1	UTSW	4	41605686	splice site	probably benign
R0138:Dnaic1	UTSW	4	41629814	missense	possibly damaging	0.49
R0153:Dnaic1	UTSW	4	41635162	unclassified	probably benign
R0465:Dnaic1	UTSW	4	41629988	splice site	probably null
R0550:Dnaic1	UTSW	4	41596274	nonsense	probably null
R0555:Dnaic1	UTSW	4	41625335	missense	possibly damaging	0.64
R0890:Dnaic1	UTSW	4	41604253	missense	possibly damaging	0.69
R0928:Dnaic1	UTSW	4	41602566	missense	possibly damaging	0.57
R0944:Dnaic1	UTSW	4	41629997	missense	probably benign
R1714:Dnaic1	UTSW	4	41632164	missense	probably benign	0.12
R1902:Dnaic1	UTSW	4	41625319	nonsense	probably null
R1919:Dnaic1	UTSW	4	41570020	critical splice donor site	probably null
R1983:Dnaic1	UTSW	4	41603232	missense	probably benign
R2036:Dnaic1	UTSW	4	41632225	missense	probably damaging	1.00
R2306:Dnaic1	UTSW	4	41625239	missense	probably benign
R2925:Dnaic1	UTSW	4	41597919	missense	probably damaging	1.00
R3404:Dnaic1	UTSW	4	41603246	missense	probably benign	0.00
R3720:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3721:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3722:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3931:Dnaic1	UTSW	4	41604229	missense	probably damaging	1.00
R4330:Dnaic1	UTSW	4	41637966	missense	probably damaging	1.00
R4755:Dnaic1	UTSW	4	41610269	missense	probably damaging	0.99
R4905:Dnaic1	UTSW	4	41614269	missense	probably benign	0.05
R4997:Dnaic1	UTSW	4	41597919	missense	possibly damaging	0.80
R5088:Dnaic1	UTSW	4	41597630	missense	probably benign	0.00
R5088:Dnaic1	UTSW	4	41632251	missense	probably benign	0.02
R5970:Dnaic1	UTSW	4	41625281	missense	probably benign	0.14
R5987:Dnaic1	UTSW	4	41632391	missense	probably benign	0.03
R6247:Dnaic1	UTSW	4	41605775	missense	probably benign
R6727:Dnaic1	UTSW	4	41625308	missense	probably benign
R6874:Dnaic1	UTSW	4	41632412	missense	probably damaging	1.00
R6914:Dnaic1	UTSW	4	41625176	missense	probably benign	0.01
R7508:Dnaic1	UTSW	4	41614323	missense	probably benign	0.01
R7831:Dnaic1	UTSW	4	41614695	critical splice donor site	probably null
R7832:Dnaic1	UTSW	4	41605823	missense	probably benign	0.42
R7985:Dnaic1	UTSW	4	41630055	missense	probably benign
R8065:Dnaic1	UTSW	4	41614258	missense	probably damaging	1.00
R8067:Dnaic1	UTSW	4	41614258	missense	probably damaging	1.00
R8234:Dnaic1	UTSW	4	41625221	missense	probably benign	0.00
R8906:Dnaic1	UTSW	4	41625125	missense	probably benign	0.00
R9723:Dnaic1	UTSW	4	41603302	missense	possibly damaging	0.95
X0065:Dnaic1	UTSW	4	41629868	missense	possibly damaging	0.89
Z1176:Dnaic1	UTSW	4	41614323	missense	probably benign	0.32
Z1177:Dnaic1	UTSW	4	41569809	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AATGCTCTGACTGCTATGGTGG -3'
(R):5'- ATGTGAACCAGCTCGCTCTG -3'

Sequencing Primer
(F):5'- TGGCCCCAGGTTGGAAACAG -3'
(R):5'- TCTGCAGGCAGAGGGATG -3'

Posted On

2022-07-18