Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Tnc'

719732

Institutional Source

Beutler Lab

Gene Symbol

Tnc

Ensembl Gene

ENSMUSG00000028364

Gene Name

tenascin C

Synonyms

TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63959785-64047015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63966584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1818 (I1818N)

Ref Sequence

ENSEMBL: ENSMUSP00000030056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]

AlphaFold

Q80YX1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030056
AA Change: I1818N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: I1818N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107372
AA Change: I1909N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: I1909N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	2.75e0	SMART
FN3	1529	1608	3.4e-4	SMART
FN3	1619	1697	1.55e-7	SMART
FN3	1708	1785	1.53e-6	SMART
FN3	1796	1873	7.75e-8	SMART
FBG	1888	2098	4.08e-124	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107377
AA Change: I1818N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: I1818N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Tnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Tnc	APN	4	64016824	splice site	probably benign
IGL00531:Tnc	APN	4	63971153	splice site	probably benign
IGL00674:Tnc	APN	4	63965607	missense	probably damaging	1.00
IGL01015:Tnc	APN	4	64017334	missense	probably benign	0.19
IGL01090:Tnc	APN	4	64000080	missense	probably damaging	1.00
IGL01310:Tnc	APN	4	64013077	missense	probably benign	0.03
IGL01331:Tnc	APN	4	63982875	missense	probably damaging	0.99
IGL01393:Tnc	APN	4	64014054	splice site	probably benign
IGL01411:Tnc	APN	4	64000722	missense	probably damaging	0.96
IGL01472:Tnc	APN	4	64006419	missense	probably benign	0.00
IGL01552:Tnc	APN	4	63970408	missense	probably damaging	1.00
IGL01661:Tnc	APN	4	63970307	splice site	probably benign
IGL01669:Tnc	APN	4	64000701	missense	probably damaging	1.00
IGL01912:Tnc	APN	4	64008740	missense	probably damaging	1.00
IGL02028:Tnc	APN	4	63966672	splice site	probably benign
IGL02100:Tnc	APN	4	64000161	missense	possibly damaging	0.84
IGL02549:Tnc	APN	4	64015072	missense	probably damaging	1.00
IGL02642:Tnc	APN	4	63965579	splice site	probably benign
IGL02712:Tnc	APN	4	63975256	missense	probably damaging	1.00
IGL02876:Tnc	APN	4	64015101	missense	possibly damaging	0.56
IGL02886:Tnc	APN	4	64000107	missense	probably damaging	0.96
IGL02972:Tnc	APN	4	63976478	missense	probably benign	0.11
IGL03073:Tnc	APN	4	63971224	missense	possibly damaging	0.58
IGL03116:Tnc	APN	4	64014033	missense	probably damaging	1.00
IGL03181:Tnc	APN	4	63967306	missense	possibly damaging	0.95
IGL03358:Tnc	APN	4	64017615	nonsense	probably null
tancredo	UTSW	4	63993297	nonsense	probably null
BB009:Tnc	UTSW	4	64008620	missense	probably benign
BB019:Tnc	UTSW	4	64008620	missense	probably benign
P0020:Tnc	UTSW	4	64008857	missense	possibly damaging	0.63
PIT4377001:Tnc	UTSW	4	64017736	missense	probably damaging	1.00
PIT4403001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
PIT4468001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
R0243:Tnc	UTSW	4	63970420	missense	probably damaging	0.98
R0362:Tnc	UTSW	4	64017442	missense	probably damaging	1.00
R0410:Tnc	UTSW	4	64007694	missense	probably benign	0.00
R0420:Tnc	UTSW	4	64000159	missense	probably benign	0.00
R0540:Tnc	UTSW	4	64020455	missense	probably damaging	1.00
R0650:Tnc	UTSW	4	64008734	missense	probably benign	0.00
R1019:Tnc	UTSW	4	63962082	missense	probably damaging	1.00
R1102:Tnc	UTSW	4	64020468	missense	probably benign	0.05
R1126:Tnc	UTSW	4	64018120	missense	probably damaging	0.99
R1141:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1142:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1307:Tnc	UTSW	4	64008859	missense	probably damaging	0.98
R1322:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1414:Tnc	UTSW	4	63965695	splice site	probably benign
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1499:Tnc	UTSW	4	63964754	missense	probably benign	0.15
R1506:Tnc	UTSW	4	64007684	missense	possibly damaging	0.90
R1597:Tnc	UTSW	4	64006384	missense	probably benign
R1750:Tnc	UTSW	4	63972735	missense	probably damaging	1.00
R1765:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1783:Tnc	UTSW	4	64018096	missense	probably damaging	0.98
R1808:Tnc	UTSW	4	63999931	missense	probably damaging	1.00
R1903:Tnc	UTSW	4	64000062	missense	probably benign	0.00
R1932:Tnc	UTSW	4	63993025	critical splice donor site	probably null
R1941:Tnc	UTSW	4	64014964	missense	probably damaging	1.00
R1983:Tnc	UTSW	4	63984630	missense	possibly damaging	0.95
R2024:Tnc	UTSW	4	63964621	missense	probably damaging	1.00
R2075:Tnc	UTSW	4	63995666	missense	possibly damaging	0.94
R2327:Tnc	UTSW	4	63975238	missense	possibly damaging	0.78
R2444:Tnc	UTSW	4	64014963	missense	probably damaging	1.00
R2982:Tnc	UTSW	4	64020519	missense	possibly damaging	0.81
R3874:Tnc	UTSW	4	64008710	missense	probably damaging	1.00
R4110:Tnc	UTSW	4	64014951	missense	probably damaging	1.00
R4360:Tnc	UTSW	4	64016924	missense	probably benign	0.35
R4371:Tnc	UTSW	4	63970351	missense	probably damaging	1.00
R4434:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4438:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4570:Tnc	UTSW	4	63995672	missense	probably damaging	0.99
R4595:Tnc	UTSW	4	63995745	missense	probably damaging	1.00
R4749:Tnc	UTSW	4	63995639	missense	possibly damaging	0.56
R4756:Tnc	UTSW	4	63967343	missense	probably damaging	0.99
R4824:Tnc	UTSW	4	64017620	nonsense	probably null
R4957:Tnc	UTSW	4	63976556	missense	probably damaging	1.00
R4977:Tnc	UTSW	4	64006248	missense	possibly damaging	0.82
R5001:Tnc	UTSW	4	63984489	missense	probably damaging	1.00
R5001:Tnc	UTSW	4	64000062	missense	probably benign	0.16
R5015:Tnc	UTSW	4	64006502	missense	probably damaging	1.00
R5049:Tnc	UTSW	4	64017986	missense	probably damaging	1.00
R5066:Tnc	UTSW	4	63975229	missense	probably damaging	0.96
R5073:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R5116:Tnc	UTSW	4	63967215	critical splice donor site	probably null
R5195:Tnc	UTSW	4	63967252	missense	probably damaging	1.00
R5200:Tnc	UTSW	4	63971278	missense	probably damaging	1.00
R5221:Tnc	UTSW	4	63993297	nonsense	probably null
R5237:Tnc	UTSW	4	63962096	missense	probably damaging	1.00
R5265:Tnc	UTSW	4	63993206	missense	probably benign	0.00
R5275:Tnc	UTSW	4	63964730	nonsense	probably null
R5346:Tnc	UTSW	4	64008655	missense	probably benign
R5409:Tnc	UTSW	4	63966536	missense	probably damaging	1.00
R5409:Tnc	UTSW	4	64007417	missense	probably damaging	1.00
R5469:Tnc	UTSW	4	64013925	splice site	probably null
R5518:Tnc	UTSW	4	64017679	missense	probably damaging	1.00
R5560:Tnc	UTSW	4	64008709	missense	probably damaging	1.00
R5588:Tnc	UTSW	4	64006422	missense	possibly damaging	0.57
R5686:Tnc	UTSW	4	64007730	splice site	probably null
R5686:Tnc	UTSW	4	64008795	missense	possibly damaging	0.78
R5837:Tnc	UTSW	4	64013214	missense	probably damaging	1.00
R5976:Tnc	UTSW	4	64018166	missense	probably benign	0.17
R6156:Tnc	UTSW	4	63970352	missense	probably damaging	1.00
R6182:Tnc	UTSW	4	64008796	missense	probably damaging	0.99
R6360:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R6416:Tnc	UTSW	4	64007816	missense	probably benign	0.05
R6778:Tnc	UTSW	4	63995598	missense	probably benign	0.12
R6798:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6799:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6943:Tnc	UTSW	4	63982745	missense	probably damaging	0.97
R7027:Tnc	UTSW	4	63984589	missense	probably benign	0.02
R7183:Tnc	UTSW	4	64013128	missense	probably damaging	1.00
R7204:Tnc	UTSW	4	63971155	splice site	probably null
R7317:Tnc	UTSW	4	63972722	missense	probably damaging	0.99
R7323:Tnc	UTSW	4	63971232	missense	probably damaging	0.96
R7327:Tnc	UTSW	4	63964762	splice site	probably null
R7382:Tnc	UTSW	4	64014043	nonsense	probably null
R7399:Tnc	UTSW	4	64020657	start gained	probably benign
R7479:Tnc	UTSW	4	64017628	missense	possibly damaging	0.95
R7585:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R7932:Tnc	UTSW	4	64008620	missense	probably benign
R7947:Tnc	UTSW	4	64017343	missense	probably damaging	1.00
R7974:Tnc	UTSW	4	64000724	missense	possibly damaging	0.84
R7991:Tnc	UTSW	4	64008746	missense	probably benign	0.42
R8004:Tnc	UTSW	4	63984657	missense	probably benign	0.04
R8080:Tnc	UTSW	4	63976469	missense	possibly damaging	0.52
R8109:Tnc	UTSW	4	64008763	missense	probably benign	0.11
R8145:Tnc	UTSW	4	64017479	missense	probably benign
R8340:Tnc	UTSW	4	64007799	missense	probably damaging	1.00
R8360:Tnc	UTSW	4	63967274	missense	probably benign	0.00
R8671:Tnc	UTSW	4	64017446	missense	probably damaging	1.00
R8691:Tnc	UTSW	4	63962076	missense	probably damaging	1.00
R8759:Tnc	UTSW	4	64006264	missense	possibly damaging	0.86
R8864:Tnc	UTSW	4	63993059	missense	probably damaging	0.98
R8927:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8928:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8949:Tnc	UTSW	4	64008850	missense	probably damaging	1.00
R8956:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R9016:Tnc	UTSW	4	64017094	missense	probably benign	0.23
R9049:Tnc	UTSW	4	64000010	missense	possibly damaging	0.83
R9097:Tnc	UTSW	4	63970385	missense	possibly damaging	0.62
R9114:Tnc	UTSW	4	63972736	missense	probably benign	0.03
R9151:Tnc	UTSW	4	64020449	missense	possibly damaging	0.46
R9488:Tnc	UTSW	4	63995705	missense	probably damaging	0.99
R9666:Tnc	UTSW	4	64007808	missense	probably damaging	1.00
R9700:Tnc	UTSW	4	64014949	missense	probably damaging	0.99
R9703:Tnc	UTSW	4	63971175	missense	probably benign	0.00
R9771:Tnc	UTSW	4	64007363	missense	probably damaging	1.00
S24628:Tnc	UTSW	4	64018012	missense	probably damaging	1.00
Z1177:Tnc	UTSW	4	63960544	critical splice acceptor site	probably null
Z1177:Tnc	UTSW	4	64007426	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCCATGTGACAAGGATTAC -3'
(R):5'- GCTCTGTCATGAGGAACACAG -3'

Sequencing Primer
(F):5'- CCTTGCAAAGTCTTATGCACATG -3'
(R):5'- GCCTGCTTGTAGGAACCTAGTCAC -3'

Posted On

2022-07-18