Incidental Mutation 'R9537:Mier1'
ID 719733
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 103114390-103165754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103162561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 494 (N494S)
Ref Sequence ENSEMBL: ENSMUSP00000095558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect probably benign
Transcript: ENSMUST00000030247
AA Change: N466S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: N466S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097945
AA Change: N494S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: N494S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
AA Change: N268S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522
AA Change: N268S

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106857
AA Change: N449S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: N449S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106858
AA Change: N466S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: N466S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103155572 missense probably damaging 0.99
IGL01599:Mier1 APN 4 103155541 missense possibly damaging 0.58
IGL01996:Mier1 APN 4 103127276 missense possibly damaging 0.93
IGL02228:Mier1 APN 4 103131062 missense possibly damaging 0.85
R0194:Mier1 UTSW 4 103139519 splice site probably null
R0505:Mier1 UTSW 4 103155623 splice site probably benign
R0684:Mier1 UTSW 4 103139434 missense probably damaging 0.99
R0691:Mier1 UTSW 4 103139502 missense probably benign 0.07
R2997:Mier1 UTSW 4 103131036 missense probably damaging 1.00
R4273:Mier1 UTSW 4 103162431 missense possibly damaging 0.93
R4728:Mier1 UTSW 4 103140205 missense probably damaging 1.00
R4769:Mier1 UTSW 4 103140220 missense probably benign 0.01
R4798:Mier1 UTSW 4 103130998 missense probably damaging 1.00
R5075:Mier1 UTSW 4 103139473 missense probably benign 0.02
R5260:Mier1 UTSW 4 103162710 missense probably benign 0.04
R5663:Mier1 UTSW 4 103150542 missense probably damaging 0.96
R5924:Mier1 UTSW 4 103159702 nonsense probably null
R7253:Mier1 UTSW 4 103139347 splice site probably null
R7304:Mier1 UTSW 4 103139402 nonsense probably null
R7641:Mier1 UTSW 4 103139440 missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103162615 missense probably benign 0.09
R8000:Mier1 UTSW 4 103131043 missense probably damaging 1.00
R8557:Mier1 UTSW 4 103139346 splice site probably null
R9353:Mier1 UTSW 4 103155603 missense probably damaging 0.97
R9759:Mier1 UTSW 4 103162528 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTCAGATTGGTGCTTTCCTTG -3'
(R):5'- TCCTCAAACTTCCCATGTGAG -3'

Sequencing Primer
(F):5'- GTAGCAGATATTTCAGAAGAGTTGAC -3'
(R):5'- GTGAGACTGCTTCCTGGAAAAACTC -3'
Posted On 2022-07-18