Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Mib2'

719736

Institutional Source

Beutler Lab

Gene Symbol

Mib2

Ensembl Gene

ENSMUSG00000029060

Gene Name

mindbomb E3 ubiquitin protein ligase 2

Synonyms

2210008I11Rik, Zzank1

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

155654677-155669198 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 155657495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 387 (L387H)

Ref Sequence

ENSEMBL: ENSMUSP00000099465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000103176] [ENSMUST00000141108]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030937

SMART Domains

Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

Domain	Start	End	E-Value	Type
low complexity region	19	41	N/A	INTRINSIC
ZnMc	85	256	8.39e-48	SMART
ShKT	255	291	4.06e-10	SMART
IG	307	390	4.53e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103176
AA Change: L387H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: L387H

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	12	78	3.4e-26	PFAM
ZnF_ZZ	85	130	6.44e-9	SMART
Pfam:MIB_HERC2	160	225	4.2e-26	PFAM
Blast:ANK	285	320	2e-13	BLAST
ANK	428	457	8.52e-4	SMART
ANK	461	490	6.71e-2	SMART
ANK	494	523	9.93e-5	SMART
ANK	527	559	1.1e2	SMART
ANK	563	593	9.21e0	SMART
ANK	597	627	3.57e-6	SMART
ANK	631	660	3.31e-1	SMART
ANK	664	709	1.73e3	SMART
Blast:ANK	733	762	9e-10	BLAST
low complexity region	763	772	N/A	INTRINSIC
RING	798	832	2.55e-1	SMART
RING	877	909	1.81e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141108
AA Change: L248H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060
AA Change: L248H

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	1	52	7.1e-17	PFAM
internal_repeat_1	82	150	7.77e-12	PROSPERO
internal_repeat_1	153	220	7.77e-12	PROSPERO
ANK	289	318	8.52e-4	SMART
ANK	322	351	6.71e-2	SMART
Pfam:Ank	356	375	2.9e-4	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Mib2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Mib2	APN	4	155657730	missense	probably damaging	1.00
IGL01404:Mib2	APN	4	155654936	missense	probably damaging	1.00
IGL01819:Mib2	APN	4	155655258	splice site	probably null
IGL02147:Mib2	APN	4	155657687	missense	probably benign
IGL02260:Mib2	APN	4	155661171	missense	probably damaging	1.00
IGL02472:Mib2	APN	4	155656746	missense	probably damaging	1.00
IGL02632:Mib2	APN	4	155655579	missense	probably damaging	0.98
IGL03051:Mib2	APN	4	155657290	missense	probably damaging	1.00
IGL03077:Mib2	APN	4	155659443	missense	probably benign	0.01
R0042:Mib2	UTSW	4	155659440	nonsense	probably null
R0042:Mib2	UTSW	4	155659440	nonsense	probably null
R0115:Mib2	UTSW	4	155656062	unclassified	probably benign
R0193:Mib2	UTSW	4	155655673	missense	probably benign
R0279:Mib2	UTSW	4	155661216	missense	possibly damaging	0.89
R0373:Mib2	UTSW	4	155656288	missense	probably damaging	1.00
R0481:Mib2	UTSW	4	155656062	unclassified	probably benign
R0563:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0564:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0625:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0714:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0740:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0942:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0987:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1023:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1033:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1037:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1460:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1481:Mib2	UTSW	4	155656999	missense	probably benign	0.01
R1712:Mib2	UTSW	4	155654799	missense	probably damaging	1.00
R2015:Mib2	UTSW	4	155657880	missense	probably damaging	1.00
R2072:Mib2	UTSW	4	155659701	missense	probably damaging	0.99
R2131:Mib2	UTSW	4	155655238	splice site	probably null
R2187:Mib2	UTSW	4	155654933	missense	possibly damaging	0.95
R3751:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R3752:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R3753:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R4381:Mib2	UTSW	4	155657612	missense	possibly damaging	0.55
R4584:Mib2	UTSW	4	155657287	missense	probably damaging	1.00
R4669:Mib2	UTSW	4	155657415	missense	possibly damaging	0.49
R4754:Mib2	UTSW	4	155655365	missense	possibly damaging	0.90
R4782:Mib2	UTSW	4	155659772	missense	probably benign	0.00
R4799:Mib2	UTSW	4	155659772	missense	probably benign	0.00
R5036:Mib2	UTSW	4	155656288	missense	probably damaging	1.00
R5073:Mib2	UTSW	4	155656776	missense	probably damaging	1.00
R5915:Mib2	UTSW	4	155656051	unclassified	probably benign
R6695:Mib2	UTSW	4	155661172	missense	probably damaging	1.00
R7039:Mib2	UTSW	4	155659701	missense	probably damaging	0.99
R7234:Mib2	UTSW	4	155657893	missense	probably damaging	1.00
R7582:Mib2	UTSW	4	155654810	missense	probably benign
R8133:Mib2	UTSW	4	155657001	missense	probably benign	0.00
R8704:Mib2	UTSW	4	155659163	missense	possibly damaging	0.93
R8904:Mib2	UTSW	4	155659716	missense	probably damaging	0.99
R8987:Mib2	UTSW	4	155660894	missense	probably benign	0.01
R8988:Mib2	UTSW	4	155656272	missense	possibly damaging	0.47
R9336:Mib2	UTSW	4	155658937	missense	probably benign
R9640:Mib2	UTSW	4	155660868	missense	possibly damaging	0.77
X0012:Mib2	UTSW	4	155655395	splice site	probably null
Z1176:Mib2	UTSW	4	155661141	missense	probably benign	0.06
Z1177:Mib2	UTSW	4	155655521	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCAACACATGAACTCTGG -3'
(R):5'- TGGAGATGGAAACTTGCGTG -3'

Sequencing Primer
(F):5'- ACATGAACTCTGGGCACTCTC -3'
(R):5'- TCAGCGGTGGACCTTCAG -3'

Posted On

2022-07-18