Incidental Mutation 'R9537:Ing1'
ID 719746
Institutional Source Beutler Lab
Gene Symbol Ing1
Ensembl Gene ENSMUSG00000045969
Gene Name inhibitor of growth family, member 1
Synonyms 2610028J21Rik, p33Ing1, mING1h
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 11555571-11563251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11561889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 203 (L203P)
Ref Sequence ENSEMBL: ENSMUSP00000062593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054399] [ENSMUST00000209565] [ENSMUST00000209646] [ENSMUST00000210041] [ENSMUST00000210670] [ENSMUST00000210740] [ENSMUST00000211007]
AlphaFold Q9QXV3
Predicted Effect probably benign
Transcript: ENSMUST00000054399
AA Change: L203P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062593
Gene: ENSMUSG00000045969
AA Change: L203P

DomainStartEndE-ValueType
Pfam:ING 15 113 1.4e-33 PFAM
low complexity region 146 165 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
PHD 212 257 2.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209565
AA Change: L109P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000209646
AA Change: L109P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000210041
AA Change: L109P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000210670
Predicted Effect probably benign
Transcript: ENSMUST00000210740
AA Change: L109P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000211007
AA Change: L109P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a slight decrease in body weight, moderately impaired maternal nurturing, increased sensitivity to gamma-irradiation, and increased incidence of B-cell derived lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Ing1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ing1 APN 8 11561453 missense probably benign 0.33
F5770:Ing1 UTSW 8 11561934 missense probably damaging 1.00
R0422:Ing1 UTSW 8 11561933 missense probably damaging 0.98
R0546:Ing1 UTSW 8 11557031 missense probably damaging 1.00
R1295:Ing1 UTSW 8 11561501 missense probably benign 0.00
R1295:Ing1 UTSW 8 11561502 missense probably damaging 0.96
R1433:Ing1 UTSW 8 11557010 missense probably damaging 0.98
R1914:Ing1 UTSW 8 11561577 missense probably damaging 1.00
R2964:Ing1 UTSW 8 11561641 missense probably benign 0.09
R2965:Ing1 UTSW 8 11561641 missense probably benign 0.09
R4559:Ing1 UTSW 8 11562090 missense probably benign 0.01
R6884:Ing1 UTSW 8 11561916 missense probably damaging 1.00
R7775:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7778:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7824:Ing1 UTSW 8 11561814 missense probably benign 0.00
R9731:Ing1 UTSW 8 11561649 missense probably benign 0.00
V7583:Ing1 UTSW 8 11561934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCGAAGAGTGAGGCCATC -3'
(R):5'- TCTCCAGGGCTTTGTCCATG -3'

Sequencing Primer
(F):5'- TGAGGCCATCACACAGGCAG -3'
(R):5'- CAGGGCTTTGTCCATGGTCTTC -3'
Posted On 2022-07-18