Incidental Mutation 'R9537:Bean1'
ID 719747
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9537 (G1)
Quality Score 214.458
Status Not validated
Chromosome 8
Chromosomal Location 104170442-104219122 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CT to C at 104182032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably benign
Transcript: ENSMUST00000093245
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153288
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167633
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171018
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212979
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104210918 missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104217175 missense probably damaging 1.00
R0490:Bean1 UTSW 8 104215028 missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104217224 missense probably benign
R1920:Bean1 UTSW 8 104211110 missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104182011 missense probably benign 0.04
R3980:Bean1 UTSW 8 104211098 missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104213934 start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104217110 missense probably damaging 1.00
R4516:Bean1 UTSW 8 104215154 missense probably damaging 1.00
R4542:Bean1 UTSW 8 104210959 missense probably damaging 1.00
R4663:Bean1 UTSW 8 104211167 missense probably damaging 1.00
R4962:Bean1 UTSW 8 104216974 missense probably damaging 1.00
R5221:Bean1 UTSW 8 104215152 missense probably damaging 1.00
R6288:Bean1 UTSW 8 104210990 missense probably damaging 1.00
R6588:Bean1 UTSW 8 104182032 frame shift probably null
R6615:Bean1 UTSW 8 104182032 frame shift probably null
R6994:Bean1 UTSW 8 104182032 frame shift probably null
R7359:Bean1 UTSW 8 104182032 frame shift probably null
R7451:Bean1 UTSW 8 104213996 missense probably benign 0.01
R7454:Bean1 UTSW 8 104211026 missense probably damaging 1.00
R7473:Bean1 UTSW 8 104182032 frame shift probably null
R7537:Bean1 UTSW 8 104182032 frame shift probably null
R7826:Bean1 UTSW 8 104182032 frame shift probably null
R8034:Bean1 UTSW 8 104182032 frame shift probably null
R8418:Bean1 UTSW 8 104182032 frame shift probably null
R8789:Bean1 UTSW 8 104182032 frame shift probably null
R8885:Bean1 UTSW 8 104182120 critical splice donor site probably null
R8888:Bean1 UTSW 8 104182032 frame shift probably null
R8892:Bean1 UTSW 8 104216978 missense probably damaging 1.00
R8896:Bean1 UTSW 8 104182032 frame shift probably null
R8992:Bean1 UTSW 8 104182032 frame shift probably null
R9015:Bean1 UTSW 8 104182032 frame shift probably null
R9113:Bean1 UTSW 8 104213925 missense probably benign 0.00
R9122:Bean1 UTSW 8 104182032 frame shift probably null
R9135:Bean1 UTSW 8 104182032 frame shift probably null
R9151:Bean1 UTSW 8 104182032 frame shift probably null
R9255:Bean1 UTSW 8 104182032 frame shift probably null
R9340:Bean1 UTSW 8 104182107 missense probably damaging 0.99
R9363:Bean1 UTSW 8 104182032 frame shift probably null
R9417:Bean1 UTSW 8 104182032 frame shift probably null
R9566:Bean1 UTSW 8 104182032 frame shift probably null
R9731:Bean1 UTSW 8 104182032 frame shift probably null
RF054:Bean1 UTSW 8 104182032 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCCAGGTCCACTCAAGAG -3'
(R):5'- TGGTGCCATCTTTACGACTC -3'

Sequencing Primer
(F):5'- GTCCACTCAAGAGAGAGATCTGC -3'
(R):5'- CTGCCCTCTAGCTCTGCAGTAG -3'
Posted On 2022-07-18