Incidental Mutation 'R9537:Esyt3'
ID 719749
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Name extended synaptotagmin-like protein 3
Synonyms Fam62c, D9Ertd280e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 99309963-99358557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99317239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 773 (R773Q)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
AlphaFold Q5DTI8
Predicted Effect probably damaging
Transcript: ENSMUST00000042158
AA Change: R773Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: R773Q

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187520
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99315225 missense probably benign 0.07
IGL02596:Esyt3 APN 9 99328015 missense probably benign 0.02
IGL02716:Esyt3 APN 9 99317224 missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99320907 splice site probably benign
IGL03372:Esyt3 APN 9 99336056 splice site probably benign
R0008:Esyt3 UTSW 9 99338807 missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99318044 missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99316782 unclassified probably benign
R1478:Esyt3 UTSW 9 99318066 missense probably benign 0.03
R1710:Esyt3 UTSW 9 99336191 missense probably benign
R1792:Esyt3 UTSW 9 99358116 nonsense probably null
R1913:Esyt3 UTSW 9 99320311 missense probably benign 0.00
R3792:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99336192 missense probably benign
R3964:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99320838 missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99324237 missense probably benign
R4436:Esyt3 UTSW 9 99358025 intron probably benign
R5274:Esyt3 UTSW 9 99318297 missense probably benign
R5590:Esyt3 UTSW 9 99358413 utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99318207 missense probably benign 0.00
R6543:Esyt3 UTSW 9 99338772 missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99320293 missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99322153 missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99315285 missense probably benign 0.11
R7104:Esyt3 UTSW 9 99338787 missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99318170 missense probably benign
R7141:Esyt3 UTSW 9 99321440 missense probably benign 0.12
R7145:Esyt3 UTSW 9 99319574 missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99321562 missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99358064 missense probably benign 0.00
R7767:Esyt3 UTSW 9 99324971 missense probably benign 0.00
R8397:Esyt3 UTSW 9 99327913 missense probably benign 0.01
R8560:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R8882:Esyt3 UTSW 9 99320856 missense probably damaging 0.99
R9320:Esyt3 UTSW 9 99311991 missense probably damaging 1.00
R9786:Esyt3 UTSW 9 99311985 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAGCCCTTTTGACCCCATCAG -3'
(R):5'- CCTGGAGAGAATTATTGACTCGG -3'

Sequencing Primer
(F):5'- AGAAGGGCCACTCAGCACG -3'
(R):5'- CGGATGAGTCTGTGTTCCTCAC -3'
Posted On 2022-07-18