Incidental Mutation 'R9537:Esyt3'
ID 719749
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Name extended synaptotagmin-like protein 3
Synonyms D9Ertd280e, Fam62c
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 99192016-99240610 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99199292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 773 (R773Q)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
AlphaFold Q5DTI8
Predicted Effect probably damaging
Transcript: ENSMUST00000042158
AA Change: R773Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: R773Q

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187520
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,118,207 (GRCm39) Y1114H possibly damaging Het
Atp5pf A G 16: 84,625,358 (GRCm39) Y82H probably damaging Het
Bcl2a1d T G 9: 88,613,526 (GRCm39) I83L probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bglap3 T C 3: 88,276,139 (GRCm39) D71G probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Chmp2b T C 16: 65,347,932 (GRCm39) K15E probably benign Het
Chrm3 A T 13: 9,927,462 (GRCm39) W525R probably damaging Het
Col7a1 A T 9: 108,784,420 (GRCm39) K143* probably null Het
D6Ertd527e G C 6: 87,088,839 (GRCm39) S334T unknown Het
Dnai1 A G 4: 41,629,790 (GRCm39) probably null Het
Dnhd1 G A 7: 105,344,740 (GRCm39) G2028D probably damaging Het
Ffar1 T C 7: 30,560,025 (GRCm39) T291A probably benign Het
Golga2 G T 2: 32,178,313 (GRCm39) probably benign Het
Hapln2 T A 3: 87,931,780 (GRCm39) probably null Het
Ing1 T C 8: 11,611,889 (GRCm39) L203P probably benign Het
Litafd G T 16: 8,501,177 (GRCm39) C11F Het
Mab21l4 T C 1: 93,080,884 (GRCm39) K341E possibly damaging Het
Med1 T C 11: 98,062,586 (GRCm39) T171A possibly damaging Het
Mib2 A T 4: 155,741,952 (GRCm39) L387H probably damaging Het
Mier1 A G 4: 103,019,758 (GRCm39) N494S probably benign Het
Myof A G 19: 37,896,054 (GRCm39) L1847P probably damaging Het
Ndst3 A T 3: 123,465,162 (GRCm39) V270D Het
Nup160 T C 2: 90,560,088 (GRCm39) L1271S possibly damaging Het
Osgep A T 14: 51,162,119 (GRCm39) probably null Het
Ptgfr G T 3: 151,541,445 (GRCm39) T21N possibly damaging Het
Ptgs1 T C 2: 36,120,739 (GRCm39) S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Smu1 A G 4: 40,755,671 (GRCm39) S65P probably benign Het
Spef2 T C 15: 9,601,885 (GRCm39) Y1459C unknown Het
Spen A G 4: 141,199,015 (GRCm39) V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,244,156 (GRCm39) probably benign Het
Timm44 G A 8: 4,310,576 (GRCm39) T392I possibly damaging Het
Tnc A T 4: 63,884,821 (GRCm39) I1818N probably damaging Het
Trpm1 G T 7: 63,803,616 (GRCm39) probably benign Het
Ttc14 A G 3: 33,857,347 (GRCm39) Y231C probably damaging Het
Ube3b A G 5: 114,525,245 (GRCm39) R23G probably damaging Het
Usp40 T C 1: 87,935,117 (GRCm39) Y10C probably benign Het
Vmn2r107 C A 17: 20,595,149 (GRCm39) S567R probably benign Het
Zfp112 T C 7: 23,826,512 (GRCm39) Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 (GRCm39) T355S Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99,197,278 (GRCm39) missense probably benign 0.07
IGL02596:Esyt3 APN 9 99,210,068 (GRCm39) missense probably benign 0.02
IGL02716:Esyt3 APN 9 99,199,277 (GRCm39) missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99,202,960 (GRCm39) splice site probably benign
IGL03372:Esyt3 APN 9 99,218,109 (GRCm39) splice site probably benign
R0008:Esyt3 UTSW 9 99,220,860 (GRCm39) missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99,200,097 (GRCm39) missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99,198,835 (GRCm39) unclassified probably benign
R1478:Esyt3 UTSW 9 99,200,119 (GRCm39) missense probably benign 0.03
R1710:Esyt3 UTSW 9 99,218,244 (GRCm39) missense probably benign
R1792:Esyt3 UTSW 9 99,240,169 (GRCm39) nonsense probably null
R1913:Esyt3 UTSW 9 99,202,364 (GRCm39) missense probably benign 0.00
R3792:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99,218,245 (GRCm39) missense probably benign
R3964:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99,202,891 (GRCm39) missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99,206,290 (GRCm39) missense probably benign
R4436:Esyt3 UTSW 9 99,240,078 (GRCm39) intron probably benign
R5274:Esyt3 UTSW 9 99,200,350 (GRCm39) missense probably benign
R5590:Esyt3 UTSW 9 99,240,466 (GRCm39) utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99,200,260 (GRCm39) missense probably benign 0.00
R6543:Esyt3 UTSW 9 99,220,825 (GRCm39) missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99,202,346 (GRCm39) missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99,204,206 (GRCm39) missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99,197,338 (GRCm39) missense probably benign 0.11
R7104:Esyt3 UTSW 9 99,220,840 (GRCm39) missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99,200,223 (GRCm39) missense probably benign
R7141:Esyt3 UTSW 9 99,203,493 (GRCm39) missense probably benign 0.12
R7145:Esyt3 UTSW 9 99,201,627 (GRCm39) missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99,203,615 (GRCm39) missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99,240,117 (GRCm39) missense probably benign 0.00
R7767:Esyt3 UTSW 9 99,207,024 (GRCm39) missense probably benign 0.00
R8397:Esyt3 UTSW 9 99,209,966 (GRCm39) missense probably benign 0.01
R8560:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R8882:Esyt3 UTSW 9 99,202,909 (GRCm39) missense probably damaging 0.99
R9320:Esyt3 UTSW 9 99,194,044 (GRCm39) missense probably damaging 1.00
R9786:Esyt3 UTSW 9 99,194,038 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAGCCCTTTTGACCCCATCAG -3'
(R):5'- CCTGGAGAGAATTATTGACTCGG -3'

Sequencing Primer
(F):5'- AGAAGGGCCACTCAGCACG -3'
(R):5'- CGGATGAGTCTGTGTTCCTCAC -3'
Posted On 2022-07-18