Incidental Mutation 'R9537:Chmp2b'
ID 719757
Institutional Source Beutler Lab
Gene Symbol Chmp2b
Ensembl Gene ENSMUSG00000004843
Gene Name charged multivesicular body protein 2B
Synonyms chromatin modifying protein 2B, 1190006E07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 65539128-65562726 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65551046 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 15 (K15E)
Ref Sequence ENSEMBL: ENSMUSP00000004965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004965] [ENSMUST00000231259]
AlphaFold Q8BJF9
Predicted Effect probably benign
Transcript: ENSMUST00000004965
AA Change: K15E

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004965
Gene: ENSMUSG00000004843
AA Change: K15E

DomainStartEndE-ValueType
Pfam:Snf7 16 186 1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231259
AA Change: K11E

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic gene trapped allele display reduced dendritic spine and excitatory synapse density in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Chmp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Chmp2b APN 16 65562477 missense probably benign 0.01
IGL01807:Chmp2b APN 16 65540205 missense probably benign
R0256:Chmp2b UTSW 16 65540192 missense probably benign 0.18
R1688:Chmp2b UTSW 16 65551036 missense probably benign 0.00
R1923:Chmp2b UTSW 16 65545327 missense possibly damaging 0.56
R2155:Chmp2b UTSW 16 65546991 missense probably benign 0.09
R4845:Chmp2b UTSW 16 65550976 missense probably damaging 0.99
R5559:Chmp2b UTSW 16 65540430 missense probably damaging 1.00
R6333:Chmp2b UTSW 16 65540250 missense possibly damaging 0.75
R6473:Chmp2b UTSW 16 65546872 missense probably damaging 1.00
R7142:Chmp2b UTSW 16 65546908 nonsense probably null
R7339:Chmp2b UTSW 16 65545346 nonsense probably null
R7761:Chmp2b UTSW 16 65546859 missense possibly damaging 0.48
R8034:Chmp2b UTSW 16 65546883 missense probably benign 0.33
R8780:Chmp2b UTSW 16 65562536 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTAAATCGCTTACCTCTCGTAATTG -3'
(R):5'- AGGCAAATTTCAAAAGCACTGC -3'

Sequencing Primer
(F):5'- CGTAATTGCTTTCTTGCGTTAGC -3'
(R):5'- GCACTGCATATTTGTACAAATCTCTC -3'
Posted On 2022-07-18