Incidental Mutation 'R9537:Atp5j'
ID 719758
Institutional Source Beutler Lab
Gene Symbol Atp5j
Ensembl Gene ENSMUSG00000022890
Gene Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 84827866-84835625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84828470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 82 (Y82H)
Ref Sequence ENSEMBL: ENSMUSP00000023608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023608] [ENSMUST00000114191] [ENSMUST00000114193] [ENSMUST00000114195] [ENSMUST00000138279]
AlphaFold P97450
Predicted Effect probably damaging
Transcript: ENSMUST00000023608
AA Change: Y82H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023608
Gene: ENSMUSG00000022890
AA Change: Y82H

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114191
AA Change: Y82H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109829
Gene: ENSMUSG00000022890
AA Change: Y82H

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 5.6e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114193
AA Change: Y82H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109831
Gene: ENSMUSG00000022890
AA Change: Y82H

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114195
SMART Domains Protein: ENSMUSP00000109833
Gene: ENSMUSG00000053062

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 36 132 7.7e-5 SMART
IGc2 147 221 1.06e-11 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138279
AA Change: Y82H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122527
Gene: ENSMUSG00000022890
AA Change: Y82H

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 92 4.5e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Atp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Atp5j APN 16 84828472 missense probably benign 0.04
IGL02465:Atp5j APN 16 84828470 missense probably damaging 0.99
R4509:Atp5j UTSW 16 84827974 missense probably benign 0.01
R4510:Atp5j UTSW 16 84827974 missense probably benign 0.01
R4511:Atp5j UTSW 16 84827974 missense probably benign 0.01
R4648:Atp5j UTSW 16 84828455 missense probably benign 0.01
R4845:Atp5j UTSW 16 84831477 missense possibly damaging 0.56
R5973:Atp5j UTSW 16 84828440 splice site probably null
R7449:Atp5j UTSW 16 84831363 missense probably benign 0.09
R8285:Atp5j UTSW 16 84828502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGAACCTCACATGCAATTGTC -3'
(R):5'- GTACCTCCTCTCAGAAACCCTG -3'

Sequencing Primer
(F):5'- GAACCTCACATGCAATTGTCATTAAC -3'
(R):5'- CCTGTGTACCTTATTAAGACTTGATG -3'
Posted On 2022-07-18