Incidental Mutation 'R9537:Vmn2r107'
ID 719759
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Name vomeronasal 2, receptor 107
Synonyms V2r6
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20345425-20375772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20374887 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 567 (S567R)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
AlphaFold E9PZJ7
Predicted Effect probably benign
Transcript: ENSMUST00000042090
AA Change: S567R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: S567R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
BB006:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
BB016:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20357769 missense probably benign
R1237:Vmn2r107 UTSW 17 20356685 nonsense probably null
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20375221 missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20345587 missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20356879 missense probably damaging 1.00
R7299:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7301:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7375:Vmn2r107 UTSW 17 20355876 missense probably benign
R7448:Vmn2r107 UTSW 17 20375732 missense probably benign 0.00
R7495:Vmn2r107 UTSW 17 20375009 missense possibly damaging 0.71
R7589:Vmn2r107 UTSW 17 20375372 missense probably benign 0.05
R7594:Vmn2r107 UTSW 17 20360373 missense probably benign 0.03
R7678:Vmn2r107 UTSW 17 20356639 missense probably benign 0.01
R7929:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
R7974:Vmn2r107 UTSW 17 20357008 missense probably benign 0.00
R8040:Vmn2r107 UTSW 17 20375546 missense probably damaging 1.00
R8263:Vmn2r107 UTSW 17 20360352 missense probably damaging 1.00
R8426:Vmn2r107 UTSW 17 20356977 missense possibly damaging 0.91
R9175:Vmn2r107 UTSW 17 20356789 missense possibly damaging 0.79
R9642:Vmn2r107 UTSW 17 20360399 missense probably damaging 1.00
R9711:Vmn2r107 UTSW 17 20357000 missense probably damaging 1.00
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGAACAAAGTCCAGGCAATAGAT -3'
(R):5'- GGCTGACCAATGAAGTTCAAAG -3'

Sequencing Primer
(F):5'- CAAAGTCCAGGCAATAGATATGAAG -3'
(R):5'- GTGTGATGAGCAAAGTGTAACTC -3'
Posted On 2022-07-18