Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Vmn2r107'

719759

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 20374887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 567 (S567R)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042090
AA Change: S567R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: S567R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Adgra3	A	G	5: 49,960,865	Y1114H	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2009:Vmn2r107	UTSW	17	20375467	missense	probably benign	0.01
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3740:Vmn2r107	UTSW	17	20374889	missense	probably benign	0.00
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4270:Vmn2r107	UTSW	17	20355779	missense	probably benign
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6007:Vmn2r107	UTSW	17	20375054	missense	probably benign	0.19
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9175:Vmn2r107	UTSW	17	20356789	missense	possibly damaging	0.79
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GGAACAAAGTCCAGGCAATAGAT -3'
(R):5'- GGCTGACCAATGAAGTTCAAAG -3'

Sequencing Primer
(F):5'- CAAAGTCCAGGCAATAGATATGAAG -3'
(R):5'- GTGTGATGAGCAAAGTGTAACTC -3'

Posted On

2022-07-18