Incidental Mutation 'R9538:Ighv14-2'
ID 719779
Institutional Source Beutler Lab
Gene Symbol Ighv14-2
Ensembl Gene ENSMUSG00000095583
Gene Name immunoglobulin heavy variable 14-2
Synonyms Gm16683
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R9538 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113994469-113994898 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 113994585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 79 (Y79D)
Ref Sequence ENSEMBL: ENSMUSP00000100248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103467]
AlphaFold A0A075B5R7
Predicted Effect probably damaging
Transcript: ENSMUST00000103467
AA Change: Y79D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100248
Gene: ENSMUSG00000095583
AA Change: Y79D

DomainStartEndE-ValueType
IGv 36 117 5.95e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,341,513 L312P probably benign Het
Ankrd31 A G 13: 96,872,685 N1262D probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnjl A G 11: 43,579,737 T111A probably benign Het
Cmtr1 T C 17: 29,663,308 probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Diaph1 T C 18: 37,853,417 K1137E probably damaging Het
Dpysl4 C A 7: 139,090,314 A116E probably damaging Het
E2f7 A G 10: 110,780,767 K623E possibly damaging Het
Glb1l G T 1: 75,201,452 P358T probably damaging Het
Helz2 T C 2: 181,240,221 R260G probably damaging Het
Nfatc3 A G 8: 106,108,152 D710G probably benign Het
Olfr814 T G 10: 129,873,893 Y288S probably damaging Het
Ppp2r3d T C 9: 124,424,007 T50A unknown Het
Psg18 A T 7: 18,350,788 Y249N probably benign Het
Smarcc1 T C 9: 110,132,204 Y30H probably benign Het
Strn G T 17: 78,664,790 A443E possibly damaging Het
Tmem119 A G 5: 113,795,641 V33A possibly damaging Het
Vmn1r210 T A 13: 22,827,667 K150* probably null Het
Vmn1r212 A G 13: 22,883,281 F294S probably benign Het
Vmn2r67 C A 7: 85,152,119 W203L Het
Zfc3h1 A G 10: 115,385,292 D32G unknown Het
Zfp931 T C 2: 178,067,812 I260M probably benign Het
Other mutations in Ighv14-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ighv14-2 APN 12 113994759 missense possibly damaging 0.47
IGL01685:Ighv14-2 APN 12 113994501 missense probably damaging 0.99
IGL02994:Ighv14-2 APN 12 113994591 missense probably benign 0.10
IGL03222:Ighv14-2 APN 12 113994494 missense possibly damaging 0.94
R4537:Ighv14-2 UTSW 12 113994892 missense probably benign 0.27
R6004:Ighv14-2 UTSW 12 113994635 missense probably damaging 0.98
R6294:Ighv14-2 UTSW 12 113994598 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCTTAGTCTCAGGCAGCTTC -3'
(R):5'- GCCATACACTCTGTGACAGTG -3'

Sequencing Primer
(F):5'- CCTGCGGTTCTATGGTTTCTGAC -3'
(R):5'- CAATTCAGAGGTTCAGCTGC -3'
Posted On 2022-07-18