Incidental Mutation 'R9539:Sardh'
ID 719792
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Name sarcosine dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R9539 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27078405-27138344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27134298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 73 (I73F)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886] [ENSMUST00000129975] [ENSMUST00000139312] [ENSMUST00000149733]
AlphaFold Q99LB7
Predicted Effect probably damaging
Transcript: ENSMUST00000102886
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: I73F

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Predicted Effect silent
Transcript: ENSMUST00000129975
Predicted Effect probably damaging
Transcript: ENSMUST00000139312
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119866
Gene: ENSMUSG00000009614
AA Change: I73F

DomainStartEndE-ValueType
Pfam:DAO 69 197 9.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149733
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120478
Gene: ENSMUSG00000009614
AA Change: I73F

DomainStartEndE-ValueType
Pfam:DAO 69 203 9.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah1 G A 8: 41,827,584 (GRCm39) A13V probably benign Het
Bdh1 A G 16: 31,273,914 (GRCm39) T160A probably benign Het
Ccdc115 C T 1: 34,477,930 (GRCm39) probably null Het
Ccdc162 T A 10: 41,463,407 (GRCm39) E1445V possibly damaging Het
Ccdc88c T C 12: 100,901,993 (GRCm39) E1215G possibly damaging Het
Cep290 A T 10: 100,404,713 (GRCm39) E2358D probably damaging Het
Cog6 A G 3: 52,914,722 (GRCm39) S245P probably benign Het
Copb2 A T 9: 98,467,983 (GRCm39) probably null Het
Crtc1 T A 8: 70,892,115 (GRCm39) M32L probably benign Het
Dagla A C 19: 10,228,429 (GRCm39) probably null Het
Dph5 C A 3: 115,722,305 (GRCm39) P261Q probably damaging Het
Gpr137c T C 14: 45,516,187 (GRCm39) V307A probably damaging Het
Herpud2 A G 9: 25,041,936 (GRCm39) Y79H probably damaging Het
Ighg2b C T 12: 113,270,498 (GRCm39) V211I Het
Meioc C T 11: 102,565,506 (GRCm39) T318M probably damaging Het
Mterf4 T C 1: 93,229,188 (GRCm39) Y275C unknown Het
Mtfr1 T C 3: 19,271,422 (GRCm39) V198A probably benign Het
Ogfrl1 T A 1: 23,415,322 (GRCm39) I138F probably damaging Het
Pacc1 C T 1: 191,077,174 (GRCm39) Q166* probably null Het
Pf4 T A 5: 90,920,891 (GRCm39) V73D possibly damaging Het
Phldb1 T C 9: 44,627,482 (GRCm39) E321G probably damaging Het
Plch1 T C 3: 63,691,427 (GRCm39) S59G probably null Het
Pmfbp1 A G 8: 110,240,537 (GRCm39) I206M probably damaging Het
Ppp1r15a A G 7: 45,174,658 (GRCm39) V50A probably damaging Het
Ptprs T C 17: 56,725,715 (GRCm39) H1496R probably benign Het
Serpind1 G A 16: 17,157,638 (GRCm39) W278* probably null Het
Slit3 C T 11: 35,589,155 (GRCm39) Q1237* probably null Het
Smg1 T C 7: 117,744,976 (GRCm39) I3059V probably benign Het
Spart T A 3: 55,034,924 (GRCm39) W437R probably damaging Het
Spata6 C G 4: 111,685,526 (GRCm39) A477G possibly damaging Het
Suox A G 10: 128,507,383 (GRCm39) F215S probably damaging Het
Tcaf1 T C 6: 42,655,683 (GRCm39) N431S probably benign Het
Tgfbr3l G A 8: 4,299,679 (GRCm39) R154H probably damaging Het
Tll1 T C 8: 64,494,457 (GRCm39) K766R probably damaging Het
Tmem63b T A 17: 45,984,105 (GRCm39) K255* probably null Het
Tmem67 A T 4: 12,045,814 (GRCm39) L881H probably damaging Het
Tmem67 G T 4: 12,045,815 (GRCm39) L881I probably damaging Het
Tnrc6b A G 15: 80,760,544 (GRCm39) S84G probably damaging Het
Traf7 C T 17: 24,729,333 (GRCm39) V465M probably damaging Het
Ttn C T 2: 76,618,568 (GRCm39) V16239I probably damaging Het
Unc80 T C 1: 66,609,163 (GRCm39) probably null Het
Zc3h11a T C 1: 133,554,927 (GRCm39) E351G probably benign Het
Zfp942 T A 17: 22,148,014 (GRCm39) H205L probably damaging Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27,105,125 (GRCm39) missense probably benign 0.07
IGL01686:Sardh APN 2 27,079,625 (GRCm39) missense probably damaging 1.00
IGL01868:Sardh APN 2 27,117,159 (GRCm39) missense probably benign 0.35
IGL02167:Sardh APN 2 27,081,987 (GRCm39) missense probably damaging 0.98
IGL02272:Sardh APN 2 27,115,003 (GRCm39) missense probably benign 0.00
IGL02870:Sardh APN 2 27,125,503 (GRCm39) missense possibly damaging 0.93
IGL03117:Sardh APN 2 27,129,458 (GRCm39) missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27,118,326 (GRCm39) missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27,087,660 (GRCm39) missense probably damaging 1.00
R0265:Sardh UTSW 2 27,117,078 (GRCm39) splice site probably benign
R0781:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1110:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1242:Sardh UTSW 2 27,125,575 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1514:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R1565:Sardh UTSW 2 27,132,731 (GRCm39) missense probably damaging 1.00
R1832:Sardh UTSW 2 27,125,581 (GRCm39) missense possibly damaging 0.95
R1836:Sardh UTSW 2 27,105,194 (GRCm39) missense possibly damaging 0.65
R1997:Sardh UTSW 2 27,134,409 (GRCm39) missense probably damaging 0.97
R2006:Sardh UTSW 2 27,118,351 (GRCm39) missense probably damaging 1.00
R2046:Sardh UTSW 2 27,105,094 (GRCm39) missense possibly damaging 0.95
R2242:Sardh UTSW 2 27,125,527 (GRCm39) missense possibly damaging 0.93
R2897:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R4332:Sardh UTSW 2 27,105,126 (GRCm39) missense possibly damaging 0.85
R4807:Sardh UTSW 2 27,079,539 (GRCm39) missense probably benign 0.00
R4841:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4842:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4856:Sardh UTSW 2 27,134,489 (GRCm39) missense probably benign 0.02
R4936:Sardh UTSW 2 27,118,253 (GRCm39) splice site probably null
R5089:Sardh UTSW 2 27,129,625 (GRCm39) critical splice donor site probably null
R5110:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R5257:Sardh UTSW 2 27,134,271 (GRCm39) missense probably damaging 0.98
R5406:Sardh UTSW 2 27,101,096 (GRCm39) missense possibly damaging 0.72
R5450:Sardh UTSW 2 27,129,710 (GRCm39) missense possibly damaging 0.65
R5594:Sardh UTSW 2 27,110,735 (GRCm39) missense probably damaging 1.00
R5870:Sardh UTSW 2 27,110,653 (GRCm39) critical splice donor site probably null
R6014:Sardh UTSW 2 27,087,540 (GRCm39) critical splice donor site probably null
R6021:Sardh UTSW 2 27,079,655 (GRCm39) missense probably benign 0.44
R6470:Sardh UTSW 2 27,134,384 (GRCm39) missense probably damaging 1.00
R6577:Sardh UTSW 2 27,108,867 (GRCm39) missense possibly damaging 0.95
R6750:Sardh UTSW 2 27,118,269 (GRCm39) missense probably benign 0.04
R7035:Sardh UTSW 2 27,120,854 (GRCm39) missense probably damaging 1.00
R7162:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R7256:Sardh UTSW 2 27,108,824 (GRCm39) missense probably benign
R7692:Sardh UTSW 2 27,087,651 (GRCm39) missense probably benign 0.01
R7709:Sardh UTSW 2 27,131,529 (GRCm39) missense possibly damaging 0.62
R7884:Sardh UTSW 2 27,129,383 (GRCm39) missense probably damaging 0.99
R8028:Sardh UTSW 2 27,120,467 (GRCm39) missense probably damaging 1.00
R8095:Sardh UTSW 2 27,132,730 (GRCm39) missense probably damaging 1.00
R8120:Sardh UTSW 2 27,108,863 (GRCm39) missense possibly damaging 0.62
R8302:Sardh UTSW 2 27,105,122 (GRCm39) missense probably benign 0.03
R8323:Sardh UTSW 2 27,125,576 (GRCm39) missense probably damaging 1.00
R8535:Sardh UTSW 2 27,129,657 (GRCm39) missense probably damaging 1.00
R8704:Sardh UTSW 2 27,120,477 (GRCm39) missense possibly damaging 0.50
R8781:Sardh UTSW 2 27,086,715 (GRCm39) missense possibly damaging 0.95
R8858:Sardh UTSW 2 27,118,302 (GRCm39) missense probably null 1.00
R9265:Sardh UTSW 2 27,105,065 (GRCm39) missense probably damaging 0.99
R9337:Sardh UTSW 2 27,086,678 (GRCm39) missense probably benign 0.11
R9342:Sardh UTSW 2 27,120,869 (GRCm39) missense possibly damaging 0.95
R9600:Sardh UTSW 2 27,120,513 (GRCm39) missense probably benign
R9714:Sardh UTSW 2 27,079,641 (GRCm39) missense possibly damaging 0.64
X0011:Sardh UTSW 2 27,132,758 (GRCm39) missense probably damaging 1.00
Z1176:Sardh UTSW 2 27,108,902 (GRCm39) missense possibly damaging 0.52
Z1176:Sardh UTSW 2 27,108,846 (GRCm39) missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27,086,685 (GRCm39) missense probably benign 0.08
Z1177:Sardh UTSW 2 27,125,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATGAAGTCTGGCTGGC -3'
(R):5'- GAGAGCTGCTTGGAATCTGG -3'

Sequencing Primer
(F):5'- AATGAAGTCTGGCTGGCCTTCC -3'
(R):5'- TTGGAATCTGGGGCTACAACC -3'
Posted On 2022-07-18