Mutagenetix > Incidental Mutation

Incidental Mutation 'R9539:Sardh'

719792

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R9539 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27244286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 73 (I73F)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886] [ENSMUST00000129975] [ENSMUST00000139312] [ENSMUST00000149733]

AlphaFold

Q99LB7

Predicted Effect

probably damaging
Transcript: ENSMUST00000102886
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: I73F

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000129975

Predicted Effect

probably damaging
Transcript: ENSMUST00000139312
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119866
Gene: ENSMUSG00000009614
AA Change: I73F

Domain	Start	End	E-Value	Type
Pfam:DAO	69	197	9.3e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000149733
AA Change: I73F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120478
Gene: ENSMUSG00000009614
AA Change: I73F

Domain	Start	End	E-Value	Type
Pfam:DAO	69	203	9.7e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asah1	G	A	8: 41,374,547	A13V	probably benign	Het
Bdh1	A	G	16: 31,455,096	T160A	probably benign	Het
Ccdc115	C	T	1: 34,438,849		probably null	Het
Ccdc162	T	A	10: 41,587,411	E1445V	possibly damaging	Het
Ccdc88c	T	C	12: 100,935,734	E1215G	possibly damaging	Het
Cep290	A	T	10: 100,568,851	E2358D	probably damaging	Het
Cog6	A	G	3: 53,007,301	S245P	probably benign	Het
Copb2	A	T	9: 98,585,930		probably null	Het
Crtc1	T	A	8: 70,439,465	M32L	probably benign	Het
Dagla	A	C	19: 10,251,065		probably null	Het
Dph5	C	A	3: 115,928,656	P261Q	probably damaging	Het
Gpr137c	T	C	14: 45,278,730	V307A	probably damaging	Het
Herpud2	A	G	9: 25,130,640	Y79H	probably damaging	Het
Ighg2b	C	T	12: 113,306,878	V211I		Het
Meioc	C	T	11: 102,674,680	T318M	probably damaging	Het
Mterf4	T	C	1: 93,301,466	Y275C	unknown	Het
Mtfr1	T	C	3: 19,217,258	V198A	probably benign	Het
Ogfrl1	T	A	1: 23,376,241	I138F	probably damaging	Het
Pf4	T	A	5: 90,773,032	V73D	possibly damaging	Het
Phldb1	T	C	9: 44,716,185	E321G	probably damaging	Het
Plch1	T	C	3: 63,784,006	S59G	probably null	Het
Pmfbp1	A	G	8: 109,513,905	I206M	probably damaging	Het
Ppp1r15a	A	G	7: 45,525,234	V50A	probably damaging	Het
Ptprs	T	C	17: 56,418,715	H1496R	probably benign	Het
Serpind1	G	A	16: 17,339,774	W278*	probably null	Het
Slit3	C	T	11: 35,698,328	Q1237*	probably null	Het
Smg1	T	C	7: 118,145,753	I3059V	probably benign	Het
Spata6	C	G	4: 111,828,329	A477G	possibly damaging	Het
Spg20	T	A	3: 55,127,503	W437R	probably damaging	Het
Suox	A	G	10: 128,671,514	F215S	probably damaging	Het
Tcaf1	T	C	6: 42,678,749	N431S	probably benign	Het
Tgfbr3l	G	A	8: 4,249,679	R154H	probably damaging	Het
Tll1	T	C	8: 64,041,423	K766R	probably damaging	Het
Tmem206	C	T	1: 191,344,977	Q166*	probably null	Het
Tmem63b	T	A	17: 45,673,179	K255*	probably null	Het
Tmem67	A	T	4: 12,045,814	L881H	probably damaging	Het
Tmem67	G	T	4: 12,045,815	L881I	probably damaging	Het
Tnrc6b	A	G	15: 80,876,343	S84G	probably damaging	Het
Traf7	C	T	17: 24,510,359	V465M	probably damaging	Het
Ttn	C	T	2: 76,788,224	V16239I	probably damaging	Het
Unc80	T	C	1: 66,570,004		probably null	Het
Zc3h11a	T	C	1: 133,627,189	E351G	probably benign	Het
Zfp942	T	A	17: 21,929,033	H205L	probably damaging	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAATGAAGTCTGGCTGGC -3'
(R):5'- GAGAGCTGCTTGGAATCTGG -3'

Sequencing Primer
(F):5'- AATGAAGTCTGGCTGGCCTTCC -3'
(R):5'- TTGGAATCTGGGGCTACAACC -3'

Posted On

2022-07-18