Incidental Mutation 'R9539:Copb2'
ID 719813
Institutional Source Beutler Lab
Gene Symbol Copb2
Ensembl Gene ENSMUSG00000032458
Gene Name COPI coat complex subunit beta 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9539 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 98445784-98470428 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 98467983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035033] [ENSMUST00000035034]
AlphaFold O55029
Predicted Effect probably null
Transcript: ENSMUST00000035033
SMART Domains Protein: ENSMUSP00000035033
Gene: ENSMUSG00000032458

DomainStartEndE-ValueType
WD40 4 43 1.18e-1 SMART
WD40 46 85 3.9e-2 SMART
WD40 88 127 4.05e-9 SMART
WD40 131 171 1.51e-8 SMART
WD40 174 215 7.97e-8 SMART
WD40 218 257 5.9e-11 SMART
Pfam:Coatomer_WDAD 319 763 3.2e-176 PFAM
low complexity region 876 892 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035034
SMART Domains Protein: ENSMUSP00000035034
Gene: ENSMUSG00000032459

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Pfam:MRP-S22 67 308 7.5e-111 PFAM
low complexity region 311 322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi coatomer complex (see MIM 601924) constitutes the coat of nonclathrin-coated vesicles and is essential for Golgi budding and vesicular trafficking. It consists of 7 protein subunits, including COPB2.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah1 G A 8: 41,827,584 (GRCm39) A13V probably benign Het
Bdh1 A G 16: 31,273,914 (GRCm39) T160A probably benign Het
Ccdc115 C T 1: 34,477,930 (GRCm39) probably null Het
Ccdc162 T A 10: 41,463,407 (GRCm39) E1445V possibly damaging Het
Ccdc88c T C 12: 100,901,993 (GRCm39) E1215G possibly damaging Het
Cep290 A T 10: 100,404,713 (GRCm39) E2358D probably damaging Het
Cog6 A G 3: 52,914,722 (GRCm39) S245P probably benign Het
Crtc1 T A 8: 70,892,115 (GRCm39) M32L probably benign Het
Dagla A C 19: 10,228,429 (GRCm39) probably null Het
Dph5 C A 3: 115,722,305 (GRCm39) P261Q probably damaging Het
Gpr137c T C 14: 45,516,187 (GRCm39) V307A probably damaging Het
Herpud2 A G 9: 25,041,936 (GRCm39) Y79H probably damaging Het
Ighg2b C T 12: 113,270,498 (GRCm39) V211I Het
Meioc C T 11: 102,565,506 (GRCm39) T318M probably damaging Het
Mterf4 T C 1: 93,229,188 (GRCm39) Y275C unknown Het
Mtfr1 T C 3: 19,271,422 (GRCm39) V198A probably benign Het
Ogfrl1 T A 1: 23,415,322 (GRCm39) I138F probably damaging Het
Pacc1 C T 1: 191,077,174 (GRCm39) Q166* probably null Het
Pf4 T A 5: 90,920,891 (GRCm39) V73D possibly damaging Het
Phldb1 T C 9: 44,627,482 (GRCm39) E321G probably damaging Het
Plch1 T C 3: 63,691,427 (GRCm39) S59G probably null Het
Pmfbp1 A G 8: 110,240,537 (GRCm39) I206M probably damaging Het
Ppp1r15a A G 7: 45,174,658 (GRCm39) V50A probably damaging Het
Ptprs T C 17: 56,725,715 (GRCm39) H1496R probably benign Het
Sardh T A 2: 27,134,298 (GRCm39) I73F probably damaging Het
Serpind1 G A 16: 17,157,638 (GRCm39) W278* probably null Het
Slit3 C T 11: 35,589,155 (GRCm39) Q1237* probably null Het
Smg1 T C 7: 117,744,976 (GRCm39) I3059V probably benign Het
Spart T A 3: 55,034,924 (GRCm39) W437R probably damaging Het
Spata6 C G 4: 111,685,526 (GRCm39) A477G possibly damaging Het
Suox A G 10: 128,507,383 (GRCm39) F215S probably damaging Het
Tcaf1 T C 6: 42,655,683 (GRCm39) N431S probably benign Het
Tgfbr3l G A 8: 4,299,679 (GRCm39) R154H probably damaging Het
Tll1 T C 8: 64,494,457 (GRCm39) K766R probably damaging Het
Tmem63b T A 17: 45,984,105 (GRCm39) K255* probably null Het
Tmem67 A T 4: 12,045,814 (GRCm39) L881H probably damaging Het
Tmem67 G T 4: 12,045,815 (GRCm39) L881I probably damaging Het
Tnrc6b A G 15: 80,760,544 (GRCm39) S84G probably damaging Het
Traf7 C T 17: 24,729,333 (GRCm39) V465M probably damaging Het
Ttn C T 2: 76,618,568 (GRCm39) V16239I probably damaging Het
Unc80 T C 1: 66,609,163 (GRCm39) probably null Het
Zc3h11a T C 1: 133,554,927 (GRCm39) E351G probably benign Het
Zfp942 T A 17: 22,148,014 (GRCm39) H205L probably damaging Het
Other mutations in Copb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Copb2 APN 9 98,450,130 (GRCm39) missense probably benign 0.00
IGL00496:Copb2 APN 9 98,452,371 (GRCm39) missense probably benign 0.00
IGL00518:Copb2 APN 9 98,464,947 (GRCm39) missense possibly damaging 0.95
IGL00642:Copb2 APN 9 98,461,086 (GRCm39) missense probably damaging 1.00
IGL00793:Copb2 APN 9 98,467,057 (GRCm39) missense probably benign
IGL00806:Copb2 APN 9 98,452,717 (GRCm39) missense probably damaging 0.97
IGL01599:Copb2 APN 9 98,463,203 (GRCm39) missense probably damaging 0.98
IGL01906:Copb2 APN 9 98,462,383 (GRCm39) missense probably benign 0.10
IGL02129:Copb2 APN 9 98,467,976 (GRCm39) unclassified probably benign
IGL02138:Copb2 APN 9 98,469,605 (GRCm39) missense probably benign
IGL03033:Copb2 APN 9 98,452,426 (GRCm39) missense probably benign 0.10
R0646:Copb2 UTSW 9 98,445,528 (GRCm39) unclassified probably benign
R0709:Copb2 UTSW 9 98,445,220 (GRCm39) unclassified probably benign
R1631:Copb2 UTSW 9 98,462,213 (GRCm39) missense probably benign 0.00
R2510:Copb2 UTSW 9 98,453,701 (GRCm39) splice site probably benign
R4862:Copb2 UTSW 9 98,463,320 (GRCm39) missense probably damaging 1.00
R5322:Copb2 UTSW 9 98,468,029 (GRCm39) missense probably benign 0.03
R5593:Copb2 UTSW 9 98,469,091 (GRCm39) critical splice acceptor site probably null
R5745:Copb2 UTSW 9 98,456,164 (GRCm39) missense probably damaging 0.99
R5859:Copb2 UTSW 9 98,450,161 (GRCm39) missense probably benign 0.17
R5990:Copb2 UTSW 9 98,452,378 (GRCm39) missense probably damaging 1.00
R7109:Copb2 UTSW 9 98,463,333 (GRCm39) critical splice donor site probably null
R7124:Copb2 UTSW 9 98,459,106 (GRCm39) missense probably damaging 0.98
R7211:Copb2 UTSW 9 98,456,198 (GRCm39) missense probably damaging 1.00
R7829:Copb2 UTSW 9 98,470,147 (GRCm39) missense probably damaging 0.99
R7960:Copb2 UTSW 9 98,462,407 (GRCm39) missense possibly damaging 0.65
R8311:Copb2 UTSW 9 98,450,072 (GRCm39) missense possibly damaging 0.78
R8537:Copb2 UTSW 9 98,469,672 (GRCm39) missense probably null 0.00
R8982:Copb2 UTSW 9 98,456,164 (GRCm39) missense probably damaging 0.99
R9762:Copb2 UTSW 9 98,464,901 (GRCm39) missense probably benign 0.38
R9800:Copb2 UTSW 9 98,461,081 (GRCm39) missense probably damaging 0.99
Z1176:Copb2 UTSW 9 98,468,199 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATCATGTCTTCCTTTGACTGACAG -3'
(R):5'- CACTGCTTACAACTCCTTAAAAGTG -3'

Sequencing Primer
(F):5'- CTTTGACTGACAGAGCCAATTTACC -3'
(R):5'- GACCTTGAGATAATACTTACTTGCCC -3'
Posted On 2022-07-18