Incidental Mutation 'R9539:Gpr137c'
ID 719821
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene Name G protein-coupled receptor 137C
Synonyms LOC380893, 6330416L11Rik, TM7SF1L2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9539 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 45219717-45282725 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45278730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000120015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378] [ENSMUST00000146150] [ENSMUST00000151749]
AlphaFold E9Q343
Predicted Effect probably benign
Transcript: ENSMUST00000022378
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146150
AA Change: V307A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151749
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah1 G A 8: 41,374,547 A13V probably benign Het
Bdh1 A G 16: 31,455,096 T160A probably benign Het
Ccdc115 C T 1: 34,438,849 probably null Het
Ccdc162 T A 10: 41,587,411 E1445V possibly damaging Het
Ccdc88c T C 12: 100,935,734 E1215G possibly damaging Het
Cep290 A T 10: 100,568,851 E2358D probably damaging Het
Cog6 A G 3: 53,007,301 S245P probably benign Het
Copb2 A T 9: 98,585,930 probably null Het
Crtc1 T A 8: 70,439,465 M32L probably benign Het
Dagla A C 19: 10,251,065 probably null Het
Dph5 C A 3: 115,928,656 P261Q probably damaging Het
Herpud2 A G 9: 25,130,640 Y79H probably damaging Het
Ighg2b C T 12: 113,306,878 V211I Het
Meioc C T 11: 102,674,680 T318M probably damaging Het
Mterf4 T C 1: 93,301,466 Y275C unknown Het
Mtfr1 T C 3: 19,217,258 V198A probably benign Het
Ogfrl1 T A 1: 23,376,241 I138F probably damaging Het
Pf4 T A 5: 90,773,032 V73D possibly damaging Het
Phldb1 T C 9: 44,716,185 E321G probably damaging Het
Plch1 T C 3: 63,784,006 S59G probably null Het
Pmfbp1 A G 8: 109,513,905 I206M probably damaging Het
Ppp1r15a A G 7: 45,525,234 V50A probably damaging Het
Ptprs T C 17: 56,418,715 H1496R probably benign Het
Sardh T A 2: 27,244,286 I73F probably damaging Het
Serpind1 G A 16: 17,339,774 W278* probably null Het
Slit3 C T 11: 35,698,328 Q1237* probably null Het
Smg1 T C 7: 118,145,753 I3059V probably benign Het
Spata6 C G 4: 111,828,329 A477G possibly damaging Het
Spg20 T A 3: 55,127,503 W437R probably damaging Het
Suox A G 10: 128,671,514 F215S probably damaging Het
Tcaf1 T C 6: 42,678,749 N431S probably benign Het
Tgfbr3l G A 8: 4,249,679 R154H probably damaging Het
Tll1 T C 8: 64,041,423 K766R probably damaging Het
Tmem206 C T 1: 191,344,977 Q166* probably null Het
Tmem63b T A 17: 45,673,179 K255* probably null Het
Tmem67 A T 4: 12,045,814 L881H probably damaging Het
Tmem67 G T 4: 12,045,815 L881I probably damaging Het
Tnrc6b A G 15: 80,876,343 S84G probably damaging Het
Traf7 C T 17: 24,510,359 V465M probably damaging Het
Ttn C T 2: 76,788,224 V16239I probably damaging Het
Unc80 T C 1: 66,570,004 probably null Het
Zc3h11a T C 1: 133,627,189 E351G probably benign Het
Zfp942 T A 17: 21,929,033 H205L probably damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45279065 utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45278963 missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45220276 missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4037:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4038:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45279027 missense probably damaging 1.00
R7238:Gpr137c UTSW 14 45278691 missense probably damaging 1.00
R7365:Gpr137c UTSW 14 45279014 missense probably damaging 1.00
R9515:Gpr137c UTSW 14 45278772 nonsense probably null
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGTCCTTGAGGGGAAAATAATC -3'
(R):5'- TGGACACAGCATTAAAGACTGG -3'

Sequencing Primer
(F):5'- GTCCTTGAGGGGAAAATAATCATTAC -3'
(R):5'- CTGGGTGAAGGCAGAGACCAC -3'
Posted On 2022-07-18