Mutagenetix > Incidental Mutation

Incidental Mutation 'R9540:Zap70'

719831

Institutional Source

Beutler Lab

Gene Symbol

Zap70

Ensembl Gene

ENSMUSG00000026117

Gene Name

zeta-chain (TCR) associated protein kinase

Synonyms

ZAP-70, TZK, Srk

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R9540 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36800879-36821899 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36817869 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 290 (Y290C)

Ref Sequence

ENSEMBL: ENSMUSP00000027291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027291]

AlphaFold

P43404

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027291
AA Change: Y290C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: Y290C

Domain	Start	End	E-Value	Type
SH2	8	93	6.73e-25	SMART
SH2	161	245	1.59e-26	SMART
low complexity region	257	265	N/A	INTRINSIC
TyrKc	337	592	1e-128	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,134,237 (GRCm39)	M450K	probably damaging	Het
Akr1e1	A	T	13: 4,657,393 (GRCm39)	S68R	probably damaging	Het
Alg1	A	G	16: 5,061,595 (GRCm39)	K411E	probably benign	Het
Bcl3	T	A	7: 19,556,445 (GRCm39)	D53V	probably benign	Het
Bnip3l	G	A	14: 67,246,214 (GRCm39)	P7L	possibly damaging	Het
Cpne6	T	C	14: 55,750,108 (GRCm39)	F80L	probably benign	Het
Crybg2	T	C	4: 133,816,225 (GRCm39)	V1334A	probably damaging	Het
Eif4e1b	A	G	13: 54,933,338 (GRCm39)	D118G	probably damaging	Het
Epha10	T	C	4: 124,779,751 (GRCm39)	V199A	probably damaging	Het
Fat4	A	G	3: 39,063,346 (GRCm39)	H4434R	probably benign	Het
Or10ak7	T	C	4: 118,792,034 (GRCm39)	I4V	probably benign	Het
Pcdhb16	A	G	18: 37,613,320 (GRCm39)	D760G	probably benign	Het
Pcx	T	A	19: 4,651,682 (GRCm39)	S20T	probably benign	Het
Pkhd1	A	C	1: 20,269,570 (GRCm39)	S3325A	probably benign	Het
Ppp1r3c	T	C	19: 36,711,461 (GRCm39)	D103G	probably benign	Het
Sds	G	T	5: 120,618,927 (GRCm39)	W130L	probably benign	Het
Trappc14	A	G	5: 138,260,127 (GRCm39)	I338T	probably benign	Het
Ugt2b1	A	T	5: 87,069,771 (GRCm39)	N323K	possibly damaging	Het
Vcam1	A	G	3: 115,911,019 (GRCm39)	S460P	possibly damaging	Het
Zzz3	G	A	3: 152,156,306 (GRCm39)	W687*	probably null	Het

Other mutations in Zap70

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
mrtless	APN	1	36,820,230 (GRCm39)	missense	probably damaging	1.00
murdock	APN	1	36,818,785 (GRCm39)	missense	probably damaging	0.99
IGL00763:Zap70	APN	1	36,818,333 (GRCm39)	missense	possibly damaging	0.81
IGL01635:Zap70	APN	1	36,810,238 (GRCm39)	missense	probably damaging	0.99
IGL01918:Zap70	APN	1	36,817,868 (GRCm39)	missense	possibly damaging	0.64
IGL02164:Zap70	APN	1	36,810,267 (GRCm39)	missense	probably damaging	0.99
IGL02502:Zap70	APN	1	36,817,887 (GRCm39)	splice site	probably benign
IGL02597:Zap70	APN	1	36,811,001 (GRCm39)	nonsense	probably null
IGL03026:Zap70	APN	1	36,818,798 (GRCm39)	missense	possibly damaging	0.94
biscayne	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
mesa_verde	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
shazzam	UTSW	1	36,820,218 (GRCm39)	missense	probably damaging	1.00
trebia	UTSW	1	36,820,106 (GRCm39)	missense	probably damaging	1.00
wanna	UTSW	1	36,810,064 (GRCm39)	missense	probably damaging	1.00
wanna2	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
wanna3	UTSW	1	36,817,299 (GRCm39)	missense	probably damaging	0.99
wanna4	UTSW	1	36,820,446 (GRCm39)	missense	probably damaging	1.00
want_to	UTSW	1	36,821,598 (GRCm39)	missense	probably damaging	1.00
waterfowl	UTSW	1	36,809,892 (GRCm39)	start codon destroyed	probably null	0.03
zapatos	UTSW	1	36,810,262 (GRCm39)	missense	possibly damaging	0.89
zipper	UTSW	1	36,809,983 (GRCm39)	missense	probably benign	0.09
PIT1430001:Zap70	UTSW	1	36,818,250 (GRCm39)	missense	possibly damaging	0.95
R0487:Zap70	UTSW	1	36,818,365 (GRCm39)	missense	probably damaging	1.00
R0701:Zap70	UTSW	1	36,820,258 (GRCm39)	missense	probably damaging	1.00
R0960:Zap70	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
R1520:Zap70	UTSW	1	36,810,036 (GRCm39)	missense	probably damaging	1.00
R2064:Zap70	UTSW	1	36,818,215 (GRCm39)	missense	probably benign
R3623:Zap70	UTSW	1	36,818,216 (GRCm39)	missense	probably benign	0.03
R3689:Zap70	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
R3690:Zap70	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
R3804:Zap70	UTSW	1	36,810,223 (GRCm39)	missense	possibly damaging	0.58
R3840:Zap70	UTSW	1	36,817,498 (GRCm39)	missense	probably damaging	1.00
R4260:Zap70	UTSW	1	36,818,189 (GRCm39)	splice site	probably benign
R4383:Zap70	UTSW	1	36,820,042 (GRCm39)	missense	probably damaging	1.00
R4632:Zap70	UTSW	1	36,817,539 (GRCm39)	missense	probably benign
R4783:Zap70	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
R5051:Zap70	UTSW	1	36,820,532 (GRCm39)	missense	probably benign	0.00
R5271:Zap70	UTSW	1	36,820,446 (GRCm39)	missense	probably damaging	1.00
R5304:Zap70	UTSW	1	36,817,299 (GRCm39)	missense	probably damaging	0.99
R5792:Zap70	UTSW	1	36,818,090 (GRCm39)	intron	probably benign
R5932:Zap70	UTSW	1	36,820,227 (GRCm39)	missense	probably damaging	1.00
R5941:Zap70	UTSW	1	36,810,030 (GRCm39)	missense	probably damaging	1.00
R6694:Zap70	UTSW	1	36,821,598 (GRCm39)	missense	probably damaging	1.00
R6825:Zap70	UTSW	1	36,817,471 (GRCm39)	missense	probably damaging	1.00
R7039:Zap70	UTSW	1	36,817,832 (GRCm39)	missense	probably benign
R7704:Zap70	UTSW	1	36,818,395 (GRCm39)	critical splice donor site	probably null
R7769:Zap70	UTSW	1	36,809,983 (GRCm39)	missense	probably benign	0.09
R8115:Zap70	UTSW	1	36,820,287 (GRCm39)	missense	probably damaging	1.00
R8140:Zap70	UTSW	1	36,810,262 (GRCm39)	missense	possibly damaging	0.89
R8289:Zap70	UTSW	1	36,820,218 (GRCm39)	missense	probably damaging	1.00
R9186:Zap70	UTSW	1	36,818,832 (GRCm39)	missense	possibly damaging	0.66
R9654:Zap70	UTSW	1	36,818,327 (GRCm39)	missense	probably benign	0.03
R9674:Zap70	UTSW	1	36,810,150 (GRCm39)	missense	probably benign	0.10
S24628:Zap70	UTSW	1	36,809,892 (GRCm39)	start codon destroyed	probably null	0.03
Z1176:Zap70	UTSW	1	36,818,257 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTCCCTAACAGTTGCTG -3'
(R):5'- CTAGGATATACAGGCCCATGGG -3'

Sequencing Primer
(F):5'- CCATCCACATTCACTCAGGTG -3'
(R):5'- GCAGGCGTGATGACTAAGCATTG -3'

Posted On

2022-07-18