Incidental Mutation 'R9541:Mindy3'
ID 719856
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene Name MINDY lysine 48 deubiquitinase 3
Synonyms 5830410F13Rik, 2310047O13Rik, 1810041E18Rik, Fam188a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 12347263-12419470 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12386638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000028105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000154899] [ENSMUST00000155530]
AlphaFold Q9CV28
Predicted Effect probably damaging
Transcript: ENSMUST00000028105
AA Change: T257A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: T257A

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124603
AA Change: T93A

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767
AA Change: T93A

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129348
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129993
AA Change: T46A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767
AA Change: T46A

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155530
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,151,655 I450V probably benign Het
Adam21 T C 12: 81,560,950 T13A probably benign Het
Adamts4 C A 1: 171,257,126 P644H probably damaging Het
Ak9 C T 10: 41,367,177 A689V Het
Ankhd1 G A 18: 36,624,644 S209N Het
Anks1b A T 10: 90,577,085 T32S probably benign Het
Atp13a4 G T 16: 29,422,726 T708K Het
B4gat1 C T 19: 5,039,868 P298S probably damaging Het
Btbd9 A G 17: 30,220,464 L583P possibly damaging Het
Ciart C A 3: 95,881,215 C104F possibly damaging Het
Coq5 T C 5: 115,279,842 S44P probably benign Het
Dennd5b A G 6: 148,998,374 V1175A probably benign Het
Filip1 T A 9: 79,819,853 K495* probably null Het
Fscn2 G A 11: 120,367,945 V439M probably damaging Het
Gcn1l1 A G 5: 115,616,357 I2339V probably benign Het
Gmppa T A 1: 75,440,450 S176R probably damaging Het
Gpatch3 G A 4: 133,578,284 E277K probably benign Het
Hcn4 A G 9: 58,860,402 D1082G probably damaging Het
Hdgfl2 T A 17: 56,098,976 D487E unknown Het
Ifna14 A T 4: 88,571,773 M9K probably null Het
Igkv4-81 A G 6: 68,990,941 Y59H Het
Il2rb T A 15: 78,488,193 N108I probably benign Het
Jarid2 C T 13: 44,914,777 R1092W possibly damaging Het
Kdm5d T G Y: 910,801 C304W probably damaging Het
Khnyn T C 14: 55,886,652 I121T possibly damaging Het
Lmcd1 A T 6: 112,329,863 H332L probably damaging Het
Lrp1b T C 2: 41,344,588 D1117G Het
Med25 A G 7: 44,891,843 V82A possibly damaging Het
Mindy2 G A 9: 70,605,226 R581C possibly damaging Het
Myo1e A T 9: 70,297,346 Y76F probably damaging Het
Npas2 A T 1: 39,338,113 I519F possibly damaging Het
Olfr1275 T A 2: 111,230,930 T288S probably damaging Het
Olfr92 C T 17: 37,111,932 D17N probably benign Het
Olfr995 T A 2: 85,438,681 H159L possibly damaging Het
Otx1 A G 11: 21,997,052 F86L probably damaging Het
Pcm1 A G 8: 41,327,579 D1856G probably benign Het
Pcsk7 G A 9: 45,909,470 E67K probably benign Het
Pkd2 A G 5: 104,460,061 Y142C probably damaging Het
Ptpre A G 7: 135,665,011 D236G probably benign Het
Rasd2 T C 8: 75,218,572 C10R probably benign Het
Rd3 C A 1: 191,985,333 R140S possibly damaging Het
Rusc1 T G 3: 89,091,615 T287P possibly damaging Het
Slc22a7 T C 17: 46,438,158 S78G probably damaging Het
Sltm A T 9: 70,573,775 H303L unknown Het
Syne4 G A 7: 30,316,918 V228I probably benign Het
Timm22 T A 11: 76,409,815 C138S possibly damaging Het
Trib2 T A 12: 15,816,826 I15L unknown Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Tyro3 T C 2: 119,812,108 V591A possibly damaging Het
Vmn2r69 A G 7: 85,407,001 V643A probably benign Het
Zfp281 G T 1: 136,627,565 Q760H probably damaging Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12355272 splice site probably benign
IGL02623:Mindy3 APN 2 12364483 nonsense probably null
R0944:Mindy3 UTSW 2 12396182 missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12396173 splice site probably null
R2066:Mindy3 UTSW 2 12419249 missense probably damaging 1.00
R2232:Mindy3 UTSW 2 12404045 missense probably benign 0.44
R2357:Mindy3 UTSW 2 12404176 splice site probably benign
R3724:Mindy3 UTSW 2 12355354 missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12401083 splice site probably null
R4089:Mindy3 UTSW 2 12364516 missense probably benign 0.21
R4175:Mindy3 UTSW 2 12405865 missense probably damaging 1.00
R4359:Mindy3 UTSW 2 12396209 missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12348199 missense probably benign 0.00
R4640:Mindy3 UTSW 2 12348163 missense probably benign 0.01
R4931:Mindy3 UTSW 2 12396213 missense probably damaging 1.00
R5926:Mindy3 UTSW 2 12348100 missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12401043 missense probably benign 0.17
R6330:Mindy3 UTSW 2 12356933 missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12382129 missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12348116 nonsense probably null
R6852:Mindy3 UTSW 2 12419252 start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12396178 critical splice donor site probably null
R7103:Mindy3 UTSW 2 12401074 missense possibly damaging 0.95
R7624:Mindy3 UTSW 2 12419189 missense probably benign 0.00
R7661:Mindy3 UTSW 2 12397517 missense probably damaging 1.00
R8474:Mindy3 UTSW 2 12400028 missense probably damaging 1.00
R8518:Mindy3 UTSW 2 12355343 missense probably damaging 1.00
R9578:Mindy3 UTSW 2 12356904 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCTTCACAGGAAAGCAAG -3'
(R):5'- GGTGAAAGAAACATTTTGCCATGG -3'

Sequencing Primer
(F):5'- AAGTACAACTAGCCGCCTTCATTTC -3'
(R):5'- ACACATGACTCAGACTTACA -3'
Posted On 2022-07-18