Incidental Mutation 'R9541:Tyro3'
ID 719861
Institutional Source Beutler Lab
Gene Symbol Tyro3
Ensembl Gene ENSMUSG00000027298
Gene Name TYRO3 protein tyrosine kinase 3
Synonyms Brt, Etk-2, Sky, Sky, Dtk, Rse, Tif
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119797733-119818104 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119812108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 591 (V591A)
Ref Sequence ENSEMBL: ENSMUSP00000028763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028763] [ENSMUST00000110783]
AlphaFold P55144
PDB Structure Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028763
AA Change: V591A

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028763
Gene: ENSMUSG00000027298
AA Change: V591A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc2 45 114 1.29e-15 SMART
IG 135 212 1.3e-2 SMART
FN3 215 297 1.5e-5 SMART
FN3 313 393 1.9e0 SMART
transmembrane domain 419 441 N/A INTRINSIC
TyrKc 508 776 1.18e-125 SMART
low complexity region 817 832 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110783
AA Change: V587A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106410
Gene: ENSMUSG00000027298
AA Change: V587A

DomainStartEndE-ValueType
IGc2 41 110 1.29e-15 SMART
IG 131 208 1.3e-2 SMART
FN3 211 293 1.5e-5 SMART
FN3 309 389 1.9e0 SMART
transmembrane domain 415 437 N/A INTRINSIC
TyrKc 504 772 1.18e-125 SMART
low complexity region 813 828 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,151,655 I450V probably benign Het
Adam21 T C 12: 81,560,950 T13A probably benign Het
Adamts4 C A 1: 171,257,126 P644H probably damaging Het
Ak9 C T 10: 41,367,177 A689V Het
Ankhd1 G A 18: 36,624,644 S209N Het
Anks1b A T 10: 90,577,085 T32S probably benign Het
Atp13a4 G T 16: 29,422,726 T708K Het
B4gat1 C T 19: 5,039,868 P298S probably damaging Het
Btbd9 A G 17: 30,220,464 L583P possibly damaging Het
Ciart C A 3: 95,881,215 C104F possibly damaging Het
Coq5 T C 5: 115,279,842 S44P probably benign Het
Dennd5b A G 6: 148,998,374 V1175A probably benign Het
Filip1 T A 9: 79,819,853 K495* probably null Het
Fscn2 G A 11: 120,367,945 V439M probably damaging Het
Gcn1l1 A G 5: 115,616,357 I2339V probably benign Het
Gmppa T A 1: 75,440,450 S176R probably damaging Het
Gpatch3 G A 4: 133,578,284 E277K probably benign Het
Hcn4 A G 9: 58,860,402 D1082G probably damaging Het
Hdgfl2 T A 17: 56,098,976 D487E unknown Het
Ifna14 A T 4: 88,571,773 M9K probably null Het
Igkv4-81 A G 6: 68,990,941 Y59H Het
Il2rb T A 15: 78,488,193 N108I probably benign Het
Jarid2 C T 13: 44,914,777 R1092W possibly damaging Het
Kdm5d T G Y: 910,801 C304W probably damaging Het
Khnyn T C 14: 55,886,652 I121T possibly damaging Het
Lmcd1 A T 6: 112,329,863 H332L probably damaging Het
Lrp1b T C 2: 41,344,588 D1117G Het
Med25 A G 7: 44,891,843 V82A possibly damaging Het
Mindy2 G A 9: 70,605,226 R581C possibly damaging Het
Mindy3 T C 2: 12,386,638 T257A probably damaging Het
Myo1e A T 9: 70,297,346 Y76F probably damaging Het
Npas2 A T 1: 39,338,113 I519F possibly damaging Het
Olfr1275 T A 2: 111,230,930 T288S probably damaging Het
Olfr92 C T 17: 37,111,932 D17N probably benign Het
Olfr995 T A 2: 85,438,681 H159L possibly damaging Het
Otx1 A G 11: 21,997,052 F86L probably damaging Het
Pcm1 A G 8: 41,327,579 D1856G probably benign Het
Pcsk7 G A 9: 45,909,470 E67K probably benign Het
Pkd2 A G 5: 104,460,061 Y142C probably damaging Het
Ptpre A G 7: 135,665,011 D236G probably benign Het
Rasd2 T C 8: 75,218,572 C10R probably benign Het
Rd3 C A 1: 191,985,333 R140S possibly damaging Het
Rusc1 T G 3: 89,091,615 T287P possibly damaging Het
Slc22a7 T C 17: 46,438,158 S78G probably damaging Het
Sltm A T 9: 70,573,775 H303L unknown Het
Syne4 G A 7: 30,316,918 V228I probably benign Het
Timm22 T A 11: 76,409,815 C138S possibly damaging Het
Trib2 T A 12: 15,816,826 I15L unknown Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn2r69 A G 7: 85,407,001 V643A probably benign Het
Zfp281 G T 1: 136,627,565 Q760H probably damaging Het
Other mutations in Tyro3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Tyro3 APN 2 119813200 missense probably damaging 1.00
IGL02221:Tyro3 APN 2 119812590 missense probably benign 0.00
IGL02389:Tyro3 APN 2 119804864 splice site probably benign
IGL02442:Tyro3 APN 2 119808868 missense probably benign 0.16
PIT4382001:Tyro3 UTSW 2 119802364 missense probably damaging 1.00
R0078:Tyro3 UTSW 2 119817006 missense probably damaging 1.00
R0087:Tyro3 UTSW 2 119801701 missense probably benign 0.38
R0503:Tyro3 UTSW 2 119803230 splice site probably benign
R0551:Tyro3 UTSW 2 119816904 missense probably damaging 1.00
R1858:Tyro3 UTSW 2 119801695 missense possibly damaging 0.95
R1902:Tyro3 UTSW 2 119801695 missense possibly damaging 0.73
R1980:Tyro3 UTSW 2 119808817 missense probably benign
R2294:Tyro3 UTSW 2 119805645 missense probably damaging 0.99
R3877:Tyro3 UTSW 2 119813293 missense probably damaging 0.98
R4651:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4652:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4698:Tyro3 UTSW 2 119803270 missense probably damaging 1.00
R4757:Tyro3 UTSW 2 119810938 missense probably damaging 1.00
R4894:Tyro3 UTSW 2 119802298 missense probably damaging 0.96
R5193:Tyro3 UTSW 2 119810517 missense probably damaging 1.00
R5366:Tyro3 UTSW 2 119804831 missense probably damaging 1.00
R5693:Tyro3 UTSW 2 119810868 missense probably damaging 1.00
R6017:Tyro3 UTSW 2 119816666 missense probably damaging 1.00
R6110:Tyro3 UTSW 2 119812823 missense probably damaging 1.00
R6160:Tyro3 UTSW 2 119803270 missense probably damaging 0.98
R6290:Tyro3 UTSW 2 119816840 missense probably benign
R6293:Tyro3 UTSW 2 119808000 missense possibly damaging 0.89
R6366:Tyro3 UTSW 2 119816675 missense probably damaging 0.96
R6712:Tyro3 UTSW 2 119804854 missense probably null 0.44
R7645:Tyro3 UTSW 2 119816906 missense probably damaging 1.00
R9378:Tyro3 UTSW 2 119812167 missense probably damaging 1.00
Z1088:Tyro3 UTSW 2 119809467 missense probably benign 0.31
Z1177:Tyro3 UTSW 2 119809991 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TATACTCAGAGCAAGGGCCAG -3'
(R):5'- ACATGTAGTTGGGCTCTGACC -3'

Sequencing Primer
(F):5'- AGAGCCCTTCACGAGTAGTC -3'
(R):5'- CCCATCAGCTCCCCGAGTC -3'
Posted On 2022-07-18