Incidental Mutation 'R9541:Dennd5b'
ID 719871
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148899872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1175 (V1175A)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: V1175A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: V1175A

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,801,079 (GRCm39) I450V probably benign Het
Adam21 T C 12: 81,607,724 (GRCm39) T13A probably benign Het
Adamts4 C A 1: 171,084,695 (GRCm39) P644H probably damaging Het
Ak9 C T 10: 41,243,173 (GRCm39) A689V Het
Ankhd1 G A 18: 36,757,697 (GRCm39) S209N Het
Anks1b A T 10: 90,412,947 (GRCm39) T32S probably benign Het
Atp13a4 G T 16: 29,241,544 (GRCm39) T708K Het
B4gat1 C T 19: 5,089,896 (GRCm39) P298S probably damaging Het
Btbd9 A G 17: 30,439,438 (GRCm39) L583P possibly damaging Het
Ciart C A 3: 95,788,527 (GRCm39) C104F possibly damaging Het
Coq5 T C 5: 115,417,901 (GRCm39) S44P probably benign Het
Filip1 T A 9: 79,727,135 (GRCm39) K495* probably null Het
Fscn2 G A 11: 120,258,771 (GRCm39) V439M probably damaging Het
Gcn1 A G 5: 115,754,416 (GRCm39) I2339V probably benign Het
Gmppa T A 1: 75,417,094 (GRCm39) S176R probably damaging Het
Gpatch3 G A 4: 133,305,595 (GRCm39) E277K probably benign Het
Hcn4 A G 9: 58,767,685 (GRCm39) D1082G probably damaging Het
Hdgfl2 T A 17: 56,405,976 (GRCm39) D487E unknown Het
Ifna14 A T 4: 88,490,010 (GRCm39) M9K probably null Het
Igkv4-81 A G 6: 68,967,925 (GRCm39) Y59H Het
Il2rb T A 15: 78,372,393 (GRCm39) N108I probably benign Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Kdm5d T G Y: 910,801 (GRCm39) C304W probably damaging Het
Khnyn T C 14: 56,124,109 (GRCm39) I121T possibly damaging Het
Lmcd1 A T 6: 112,306,824 (GRCm39) H332L probably damaging Het
Lrp1b T C 2: 41,234,600 (GRCm39) D1117G Het
Med25 A G 7: 44,541,267 (GRCm39) V82A possibly damaging Het
Mindy2 G A 9: 70,512,508 (GRCm39) R581C possibly damaging Het
Mindy3 T C 2: 12,391,449 (GRCm39) T257A probably damaging Het
Myo1e A T 9: 70,204,628 (GRCm39) Y76F probably damaging Het
Npas2 A T 1: 39,377,194 (GRCm39) I519F possibly damaging Het
Or2h2c C T 17: 37,422,824 (GRCm39) D17N probably benign Het
Or4f52 T A 2: 111,061,275 (GRCm39) T288S probably damaging Het
Or5ak25 T A 2: 85,269,025 (GRCm39) H159L possibly damaging Het
Otx1 A G 11: 21,947,052 (GRCm39) F86L probably damaging Het
Pcm1 A G 8: 41,780,616 (GRCm39) D1856G probably benign Het
Pcsk7 G A 9: 45,820,768 (GRCm39) E67K probably benign Het
Pkd2 A G 5: 104,607,927 (GRCm39) Y142C probably damaging Het
Ptpre A G 7: 135,266,740 (GRCm39) D236G probably benign Het
Rasd2 T C 8: 75,945,200 (GRCm39) C10R probably benign Het
Rd3 C A 1: 191,717,294 (GRCm39) R140S possibly damaging Het
Rusc1 T G 3: 88,998,922 (GRCm39) T287P possibly damaging Het
Slc22a7 T C 17: 46,749,084 (GRCm39) S78G probably damaging Het
Sltm A T 9: 70,481,057 (GRCm39) H303L unknown Het
Syne4 G A 7: 30,016,343 (GRCm39) V228I probably benign Het
Timm22 T A 11: 76,300,641 (GRCm39) C138S possibly damaging Het
Trib2 T A 12: 15,866,827 (GRCm39) I15L unknown Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tyro3 T C 2: 119,642,589 (GRCm39) V591A possibly damaging Het
Vmn2r69 A G 7: 85,056,209 (GRCm39) V643A probably benign Het
Zfp281 G T 1: 136,555,303 (GRCm39) Q760H probably damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATAACCTGGTCTAACC -3'
(R):5'- AATGGTTTGGGTCAGAGGAC -3'

Sequencing Primer
(F):5'- GGGCATAACCTGGTCTAACCTTTTC -3'
(R):5'- GTCAGAGGACTGGCTATGATGCC -3'
Posted On 2022-07-18