Incidental Mutation 'R9541:Filip1'
ID 719884
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 79819853 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 495 (K495*)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000093811
AA Change: K495*
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: K495*

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,151,655 I450V probably benign Het
Adam21 T C 12: 81,560,950 T13A probably benign Het
Adamts4 C A 1: 171,257,126 P644H probably damaging Het
Ak9 C T 10: 41,367,177 A689V Het
Ankhd1 G A 18: 36,624,644 S209N Het
Anks1b A T 10: 90,577,085 T32S probably benign Het
Atp13a4 G T 16: 29,422,726 T708K Het
B4gat1 C T 19: 5,039,868 P298S probably damaging Het
Btbd9 A G 17: 30,220,464 L583P possibly damaging Het
Ciart C A 3: 95,881,215 C104F possibly damaging Het
Coq5 T C 5: 115,279,842 S44P probably benign Het
Dennd5b A G 6: 148,998,374 V1175A probably benign Het
Fscn2 G A 11: 120,367,945 V439M probably damaging Het
Gcn1l1 A G 5: 115,616,357 I2339V probably benign Het
Gmppa T A 1: 75,440,450 S176R probably damaging Het
Gpatch3 G A 4: 133,578,284 E277K probably benign Het
Hcn4 A G 9: 58,860,402 D1082G probably damaging Het
Hdgfl2 T A 17: 56,098,976 D487E unknown Het
Ifna14 A T 4: 88,571,773 M9K probably null Het
Igkv4-81 A G 6: 68,990,941 Y59H Het
Il2rb T A 15: 78,488,193 N108I probably benign Het
Jarid2 C T 13: 44,914,777 R1092W possibly damaging Het
Kdm5d T G Y: 910,801 C304W probably damaging Het
Khnyn T C 14: 55,886,652 I121T possibly damaging Het
Lmcd1 A T 6: 112,329,863 H332L probably damaging Het
Lrp1b T C 2: 41,344,588 D1117G Het
Med25 A G 7: 44,891,843 V82A possibly damaging Het
Mindy2 G A 9: 70,605,226 R581C possibly damaging Het
Mindy3 T C 2: 12,386,638 T257A probably damaging Het
Myo1e A T 9: 70,297,346 Y76F probably damaging Het
Npas2 A T 1: 39,338,113 I519F possibly damaging Het
Olfr1275 T A 2: 111,230,930 T288S probably damaging Het
Olfr92 C T 17: 37,111,932 D17N probably benign Het
Olfr995 T A 2: 85,438,681 H159L possibly damaging Het
Otx1 A G 11: 21,997,052 F86L probably damaging Het
Pcm1 A G 8: 41,327,579 D1856G probably benign Het
Pcsk7 G A 9: 45,909,470 E67K probably benign Het
Pkd2 A G 5: 104,460,061 Y142C probably damaging Het
Ptpre A G 7: 135,665,011 D236G probably benign Het
Rasd2 T C 8: 75,218,572 C10R probably benign Het
Rd3 C A 1: 191,985,333 R140S possibly damaging Het
Rusc1 T G 3: 89,091,615 T287P possibly damaging Het
Slc22a7 T C 17: 46,438,158 S78G probably damaging Het
Sltm A T 9: 70,573,775 H303L unknown Het
Syne4 G A 7: 30,316,918 V228I probably benign Het
Timm22 T A 11: 76,409,815 C138S possibly damaging Het
Trib2 T A 12: 15,816,826 I15L unknown Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Tyro3 T C 2: 119,812,108 V591A possibly damaging Het
Vmn2r69 A G 7: 85,407,001 V643A probably benign Het
Zfp281 G T 1: 136,627,565 Q760H probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
R9607:Filip1 UTSW 9 79819120 missense probably damaging 1.00
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGCTCAGTTCACAGGAC -3'
(R):5'- GTCTGAACTGGAGAAGCTGG -3'

Sequencing Primer
(F):5'- AGCTCAGTTCACAGGACCTTTC -3'
(R):5'- AAGCTGGAGGAGGCCTTC -3'
Posted On 2022-07-18