Incidental Mutation 'R9541:Atp13a4'
ID 719895
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 4631413J11Rik, 9330174J19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29214671-29363682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29241544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 708 (T708K)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039090
AA Change: T727K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: T727K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: T708K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: T727K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: T727K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,801,079 (GRCm39) I450V probably benign Het
Adam21 T C 12: 81,607,724 (GRCm39) T13A probably benign Het
Adamts4 C A 1: 171,084,695 (GRCm39) P644H probably damaging Het
Ak9 C T 10: 41,243,173 (GRCm39) A689V Het
Ankhd1 G A 18: 36,757,697 (GRCm39) S209N Het
Anks1b A T 10: 90,412,947 (GRCm39) T32S probably benign Het
B4gat1 C T 19: 5,089,896 (GRCm39) P298S probably damaging Het
Btbd9 A G 17: 30,439,438 (GRCm39) L583P possibly damaging Het
Ciart C A 3: 95,788,527 (GRCm39) C104F possibly damaging Het
Coq5 T C 5: 115,417,901 (GRCm39) S44P probably benign Het
Dennd5b A G 6: 148,899,872 (GRCm39) V1175A probably benign Het
Filip1 T A 9: 79,727,135 (GRCm39) K495* probably null Het
Fscn2 G A 11: 120,258,771 (GRCm39) V439M probably damaging Het
Gcn1 A G 5: 115,754,416 (GRCm39) I2339V probably benign Het
Gmppa T A 1: 75,417,094 (GRCm39) S176R probably damaging Het
Gpatch3 G A 4: 133,305,595 (GRCm39) E277K probably benign Het
Hcn4 A G 9: 58,767,685 (GRCm39) D1082G probably damaging Het
Hdgfl2 T A 17: 56,405,976 (GRCm39) D487E unknown Het
Ifna14 A T 4: 88,490,010 (GRCm39) M9K probably null Het
Igkv4-81 A G 6: 68,967,925 (GRCm39) Y59H Het
Il2rb T A 15: 78,372,393 (GRCm39) N108I probably benign Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Kdm5d T G Y: 910,801 (GRCm39) C304W probably damaging Het
Khnyn T C 14: 56,124,109 (GRCm39) I121T possibly damaging Het
Lmcd1 A T 6: 112,306,824 (GRCm39) H332L probably damaging Het
Lrp1b T C 2: 41,234,600 (GRCm39) D1117G Het
Med25 A G 7: 44,541,267 (GRCm39) V82A possibly damaging Het
Mindy2 G A 9: 70,512,508 (GRCm39) R581C possibly damaging Het
Mindy3 T C 2: 12,391,449 (GRCm39) T257A probably damaging Het
Myo1e A T 9: 70,204,628 (GRCm39) Y76F probably damaging Het
Npas2 A T 1: 39,377,194 (GRCm39) I519F possibly damaging Het
Or2h2c C T 17: 37,422,824 (GRCm39) D17N probably benign Het
Or4f52 T A 2: 111,061,275 (GRCm39) T288S probably damaging Het
Or5ak25 T A 2: 85,269,025 (GRCm39) H159L possibly damaging Het
Otx1 A G 11: 21,947,052 (GRCm39) F86L probably damaging Het
Pcm1 A G 8: 41,780,616 (GRCm39) D1856G probably benign Het
Pcsk7 G A 9: 45,820,768 (GRCm39) E67K probably benign Het
Pkd2 A G 5: 104,607,927 (GRCm39) Y142C probably damaging Het
Ptpre A G 7: 135,266,740 (GRCm39) D236G probably benign Het
Rasd2 T C 8: 75,945,200 (GRCm39) C10R probably benign Het
Rd3 C A 1: 191,717,294 (GRCm39) R140S possibly damaging Het
Rusc1 T G 3: 88,998,922 (GRCm39) T287P possibly damaging Het
Slc22a7 T C 17: 46,749,084 (GRCm39) S78G probably damaging Het
Sltm A T 9: 70,481,057 (GRCm39) H303L unknown Het
Syne4 G A 7: 30,016,343 (GRCm39) V228I probably benign Het
Timm22 T A 11: 76,300,641 (GRCm39) C138S possibly damaging Het
Trib2 T A 12: 15,866,827 (GRCm39) I15L unknown Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tyro3 T C 2: 119,642,589 (GRCm39) V591A possibly damaging Het
Vmn2r69 A G 7: 85,056,209 (GRCm39) V643A probably benign Het
Zfp281 G T 1: 136,555,303 (GRCm39) Q760H probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29,222,596 (GRCm39) splice site probably benign
IGL01577:Atp13a4 APN 16 29,260,102 (GRCm39) missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29,234,595 (GRCm39) splice site probably benign
IGL02165:Atp13a4 APN 16 29,252,828 (GRCm39) missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29,275,447 (GRCm39) missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29,258,920 (GRCm39) missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29,241,521 (GRCm39) missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29,260,125 (GRCm39) missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29,275,489 (GRCm39) missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29,274,306 (GRCm39) missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29,274,213 (GRCm39) missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29,240,542 (GRCm39) missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29,273,652 (GRCm39) missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29,290,771 (GRCm39) missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29,239,246 (GRCm39) missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29,228,528 (GRCm39) missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29,227,746 (GRCm39) missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29,275,429 (GRCm39) missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29,298,672 (GRCm39) missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29,241,502 (GRCm39) missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29,260,102 (GRCm39) missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29,237,389 (GRCm39) missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29,360,068 (GRCm39) missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29,271,421 (GRCm39) missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29,239,653 (GRCm39) intron probably benign
R4795:Atp13a4 UTSW 16 29,308,826 (GRCm39) critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29,227,779 (GRCm39) nonsense probably null
R4996:Atp13a4 UTSW 16 29,290,822 (GRCm39) missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29,228,686 (GRCm39) missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29,275,428 (GRCm39) missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29,275,422 (GRCm39) missense possibly damaging 0.94
R5395:Atp13a4 UTSW 16 29,239,706 (GRCm39) nonsense probably null
R5640:Atp13a4 UTSW 16 29,234,649 (GRCm39) missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29,275,389 (GRCm39) missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29,252,822 (GRCm39) missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29,290,719 (GRCm39) nonsense probably null
R6497:Atp13a4 UTSW 16 29,298,719 (GRCm39) missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29,298,659 (GRCm39) missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29,288,098 (GRCm39) missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29,239,723 (GRCm39) missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29,260,014 (GRCm39) missense
R7493:Atp13a4 UTSW 16 29,290,774 (GRCm39) missense
R7712:Atp13a4 UTSW 16 29,278,305 (GRCm39) missense
R7739:Atp13a4 UTSW 16 29,275,419 (GRCm39) missense
R7897:Atp13a4 UTSW 16 29,215,284 (GRCm39) missense
R7950:Atp13a4 UTSW 16 29,268,735 (GRCm39) missense
R8217:Atp13a4 UTSW 16 29,222,619 (GRCm39) missense
R8227:Atp13a4 UTSW 16 29,222,663 (GRCm39) missense
R8273:Atp13a4 UTSW 16 29,290,720 (GRCm39) missense
R8488:Atp13a4 UTSW 16 29,236,654 (GRCm39) missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29,273,587 (GRCm39) nonsense probably null
R8773:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R8921:Atp13a4 UTSW 16 29,273,592 (GRCm39) missense
R8940:Atp13a4 UTSW 16 29,273,508 (GRCm39) critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29,290,706 (GRCm39) critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29,268,797 (GRCm39) missense
R9292:Atp13a4 UTSW 16 29,241,500 (GRCm39) missense
R9415:Atp13a4 UTSW 16 29,227,821 (GRCm39) missense
R9453:Atp13a4 UTSW 16 29,239,659 (GRCm39) missense unknown
R9497:Atp13a4 UTSW 16 29,288,130 (GRCm39) critical splice acceptor site probably null
R9614:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R9622:Atp13a4 UTSW 16 29,239,277 (GRCm39) missense
R9727:Atp13a4 UTSW 16 29,228,589 (GRCm39) missense
Z1176:Atp13a4 UTSW 16 29,241,405 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- ACTATAGCCACCACTGCGTG -3'
(R):5'- CCCAGTAAGTTATGAAGTAGCATGATG -3'

Sequencing Primer
(F):5'- ACTGCGTGGCAAGTCAG -3'
(R):5'- TAGCATGATGAAAAAGAGTCAGAATC -3'
Posted On 2022-07-18