Incidental Mutation 'R9541:Slc22a7'
ID 719898
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Name solute carrier family 22 (organic anion transporter), member 7
Synonyms NLT, OAT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9541 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 46432185-46438477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46438158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 78 (S78G)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000087012] [ENSMUST00000166852]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087012
AA Change: S78G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: S78G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166852
SMART Domains Protein: ENSMUSP00000127966
Gene: ENSMUSG00000091742

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 59 4.1e-18 PFAM
Pfam:Ribosomal_L5_C 63 161 8.7e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,151,655 I450V probably benign Het
Adam21 T C 12: 81,560,950 T13A probably benign Het
Adamts4 C A 1: 171,257,126 P644H probably damaging Het
Ak9 C T 10: 41,367,177 A689V Het
Ankhd1 G A 18: 36,624,644 S209N Het
Anks1b A T 10: 90,577,085 T32S probably benign Het
Atp13a4 G T 16: 29,422,726 T708K Het
B4gat1 C T 19: 5,039,868 P298S probably damaging Het
Btbd9 A G 17: 30,220,464 L583P possibly damaging Het
Ciart C A 3: 95,881,215 C104F possibly damaging Het
Coq5 T C 5: 115,279,842 S44P probably benign Het
Dennd5b A G 6: 148,998,374 V1175A probably benign Het
Filip1 T A 9: 79,819,853 K495* probably null Het
Fscn2 G A 11: 120,367,945 V439M probably damaging Het
Gcn1l1 A G 5: 115,616,357 I2339V probably benign Het
Gmppa T A 1: 75,440,450 S176R probably damaging Het
Gpatch3 G A 4: 133,578,284 E277K probably benign Het
Hcn4 A G 9: 58,860,402 D1082G probably damaging Het
Hdgfl2 T A 17: 56,098,976 D487E unknown Het
Ifna14 A T 4: 88,571,773 M9K probably null Het
Igkv4-81 A G 6: 68,990,941 Y59H Het
Il2rb T A 15: 78,488,193 N108I probably benign Het
Jarid2 C T 13: 44,914,777 R1092W possibly damaging Het
Kdm5d T G Y: 910,801 C304W probably damaging Het
Khnyn T C 14: 55,886,652 I121T possibly damaging Het
Lmcd1 A T 6: 112,329,863 H332L probably damaging Het
Lrp1b T C 2: 41,344,588 D1117G Het
Med25 A G 7: 44,891,843 V82A possibly damaging Het
Mindy2 G A 9: 70,605,226 R581C possibly damaging Het
Mindy3 T C 2: 12,386,638 T257A probably damaging Het
Myo1e A T 9: 70,297,346 Y76F probably damaging Het
Npas2 A T 1: 39,338,113 I519F possibly damaging Het
Olfr1275 T A 2: 111,230,930 T288S probably damaging Het
Olfr92 C T 17: 37,111,932 D17N probably benign Het
Olfr995 T A 2: 85,438,681 H159L possibly damaging Het
Otx1 A G 11: 21,997,052 F86L probably damaging Het
Pcm1 A G 8: 41,327,579 D1856G probably benign Het
Pcsk7 G A 9: 45,909,470 E67K probably benign Het
Pkd2 A G 5: 104,460,061 Y142C probably damaging Het
Ptpre A G 7: 135,665,011 D236G probably benign Het
Rasd2 T C 8: 75,218,572 C10R probably benign Het
Rd3 C A 1: 191,985,333 R140S possibly damaging Het
Rusc1 T G 3: 89,091,615 T287P possibly damaging Het
Sltm A T 9: 70,573,775 H303L unknown Het
Syne4 G A 7: 30,316,918 V228I probably benign Het
Timm22 T A 11: 76,409,815 C138S possibly damaging Het
Trib2 T A 12: 15,816,826 I15L unknown Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Tyro3 T C 2: 119,812,108 V591A possibly damaging Het
Vmn2r69 A G 7: 85,407,001 V643A probably benign Het
Zfp281 G T 1: 136,627,565 Q760H probably damaging Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46437994 splice site probably null
R0755:Slc22a7 UTSW 17 46438187 missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46433149 missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46438031 missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46433153 missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46438231 missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46437090 missense probably damaging 1.00
R2117:Slc22a7 UTSW 17 46433972 missense possibly damaging 0.55
R4467:Slc22a7 UTSW 17 46432510 missense probably benign
R4739:Slc22a7 UTSW 17 46434997 missense probably damaging 1.00
R4921:Slc22a7 UTSW 17 46436933 missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46434637 missense probably benign 0.02
R7122:Slc22a7 UTSW 17 46438298 missense probably damaging 1.00
R7412:Slc22a7 UTSW 17 46434627 missense probably benign 0.00
R7634:Slc22a7 UTSW 17 46438230 missense probably benign 0.02
R8112:Slc22a7 UTSW 17 46436830 missense probably benign 0.00
R8703:Slc22a7 UTSW 17 46434025 missense probably damaging 0.98
R9117:Slc22a7 UTSW 17 46437103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAATGGCTGGCTCAAC -3'
(R):5'- AACTGCGGAATCTGGTGCTG -3'

Sequencing Primer
(F):5'- TAATGGCTGGCTCAACCCACTC -3'
(R):5'- AATCTGGTGCTGCTGGCC -3'
Posted On 2022-07-18