Incidental Mutation 'R9542:Speg'
ID 719907
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9542 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 75422782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 2291 (P2291L)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087122
AA Change: P2291L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: P2291L

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137868
AA Change: P2038L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 T C 1: 155,567,610 S105P probably benign Het
Acot12 G A 13: 91,782,991 V453M probably damaging Het
Actr2 C T 11: 20,094,350 M85I probably benign Het
Als2cr12 C T 1: 58,678,345 A136T probably benign Het
Anxa9 T C 3: 95,303,068 D62G probably benign Het
Arnt C T 3: 95,490,643 A599V probably benign Het
Ash1l A G 3: 89,043,259 E2153G probably damaging Het
Asic5 A T 3: 82,004,543 T149S probably benign Het
Atcay G A 10: 81,207,852 T353I unknown Het
Aven T C 2: 112,625,172 F143L probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
BC024139 T A 15: 76,125,515 L149F probably damaging Het
C3 T C 17: 57,225,037 Y228C probably damaging Het
Cacna1d A G 14: 30,123,359 F640L probably benign Het
Ccdc187 T C 2: 26,255,918 R1220G possibly damaging Het
Cdc42bpb G A 12: 111,302,074 Q1231* probably null Het
Cdh20 T A 1: 104,947,342 V283E probably damaging Het
Cep63 T C 9: 102,607,334 I241V probably benign Het
Dis3 A G 14: 99,079,539 V787A probably damaging Het
Dock9 A G 14: 121,627,363 F727S probably damaging Het
Eif5b G T 1: 38,018,050 E63* probably null Het
Fanca A G 8: 123,296,339 V553A probably damaging Het
Gm13128 T C 4: 144,330,525 Y93H possibly damaging Het
Gm14085 A T 2: 122,494,341 K131N probably benign Het
Gm37240 A C 3: 84,509,889 H174Q probably benign Het
Kcnc4 C T 3: 107,458,255 W212* probably null Het
Myh2 G A 11: 67,181,176 E577K possibly damaging Het
Ncoa1 C T 12: 4,275,178 V967I possibly damaging Het
Nmur2 T C 11: 56,040,823 T21A probably damaging Het
Nrde2 A G 12: 100,144,167 C197R probably damaging Het
Olfr1097 G T 2: 86,890,469 H235Q probably benign Het
Olfr1394 C A 11: 49,160,246 C77* probably null Het
Olfr164 A T 16: 19,286,193 D183E probably benign Het
Olfr600 T C 7: 103,346,362 I189V probably benign Het
Pard3b C T 1: 62,211,627 R572* probably null Het
Pdcd6ip T C 9: 113,691,521 S132G probably damaging Het
Pdzrn3 A T 6: 101,172,274 F364L probably benign Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Pgr G T 9: 8,901,531 C355F possibly damaging Het
Pkhd1 T G 1: 20,117,780 S3435R probably damaging Het
Pkhd1l1 A G 15: 44,546,888 D2597G probably benign Het
Prrc2c T C 1: 162,680,790 E2410G possibly damaging Het
Rpap2 C G 5: 107,620,314 S339R probably benign Het
Rrp36 G C 17: 46,672,566 R69G possibly damaging Het
Rrp8 T C 7: 105,733,399 T449A probably benign Het
Scn3a T C 2: 65,536,516 D54G probably damaging Het
Serinc2 C T 4: 130,258,723 W228* probably null Het
Serpinb9g A G 13: 33,495,158 K337R probably benign Het
Spata31 A T 13: 64,922,263 I742F probably damaging Het
Ss18l2 T A 9: 121,712,600 L61* probably null Het
Suco C T 1: 161,834,099 R921H probably damaging Het
Taok2 A T 7: 126,866,836 I910N probably damaging Het
Tmem18 G A 12: 30,588,558 M106I Het
Tob1 T G 11: 94,214,408 S257A unknown Het
Trim67 G C 8: 124,794,758 K286N possibly damaging Het
Trmt112 A G 19: 6,910,588 N62S probably benign Het
Tsc2 C T 17: 24,600,334 probably null Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ube2j1 G T 4: 33,040,793 E100* probably null Het
Urgcp A T 11: 5,717,517 F317I possibly damaging Het
Vps9d1 A T 8: 123,243,783 D588E probably damaging Het
Wdr38 A T 2: 39,000,198 T115S probably damaging Het
Zfp119a G A 17: 55,865,593 Q417* probably null Het
Zfp687 C T 3: 95,009,131 C860Y probably damaging Het
Zmym4 T C 4: 126,905,371 N724S probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
R9019:Speg UTSW 1 75429238 missense probably damaging 1.00
R9027:Speg UTSW 1 75388432 missense possibly damaging 0.67
R9066:Speg UTSW 1 75385010 missense probably damaging 0.99
R9092:Speg UTSW 1 75422734 missense probably benign 0.01
R9117:Speg UTSW 1 75387800 missense probably damaging 1.00
R9202:Speg UTSW 1 75390993 missense probably damaging 1.00
R9246:Speg UTSW 1 75384854 missense probably damaging 1.00
R9248:Speg UTSW 1 75421776 missense probably damaging 1.00
R9451:Speg UTSW 1 75417733 missense probably damaging 1.00
R9452:Speg UTSW 1 75422508 missense probably benign
R9475:Speg UTSW 1 75388091 missense probably damaging 1.00
R9476:Speg UTSW 1 75401124 missense probably damaging 0.99
R9510:Speg UTSW 1 75401124 missense probably damaging 0.99
R9519:Speg UTSW 1 75415736 missense probably damaging 1.00
R9528:Speg UTSW 1 75387803 missense possibly damaging 0.78
R9553:Speg UTSW 1 75418001 missense probably benign 0.00
R9767:Speg UTSW 1 75427181 missense possibly damaging 0.78
R9768:Speg UTSW 1 75418973 nonsense probably null
R9800:Speg UTSW 1 75422714 missense probably benign 0.03
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCGAGCTGCAAAACCAG -3'
(R):5'- GTATATGCCGTCGTCCTCCG -3'

Sequencing Primer
(F):5'- GCACAACCCCCTTTGGC -3'
(R):5'- CGCGAGCGGCTCAGTAG -3'
Posted On 2022-07-18