Incidental Mutation 'R9542:Dock9'
ID 719959
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9542 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121864775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 727 (F727S)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: F727S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: F727S

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: F729S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: F729S

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: F727S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: F741S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 T C 1: 155,443,356 (GRCm39) S105P probably benign Het
Acot12 G A 13: 91,931,110 (GRCm39) V453M probably damaging Het
Actr2 C T 11: 20,044,350 (GRCm39) M85I probably benign Het
Anxa9 T C 3: 95,210,379 (GRCm39) D62G probably benign Het
Arnt C T 3: 95,397,954 (GRCm39) A599V probably benign Het
Ash1l A G 3: 88,950,566 (GRCm39) E2153G probably damaging Het
Asic5 A T 3: 81,911,850 (GRCm39) T149S probably benign Het
Atcay G A 10: 81,043,686 (GRCm39) T353I unknown Het
Aven T C 2: 112,455,517 (GRCm39) F143L probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,092,160 (GRCm39) probably benign Het
BC024139 T A 15: 76,009,715 (GRCm39) L149F probably damaging Het
C3 T C 17: 57,532,037 (GRCm39) Y228C probably damaging Het
Cacna1d A G 14: 29,845,316 (GRCm39) F640L probably benign Het
Ccdc187 T C 2: 26,145,930 (GRCm39) R1220G possibly damaging Het
Cdc42bpb G A 12: 111,268,508 (GRCm39) Q1231* probably null Het
Cdh20 T A 1: 104,875,067 (GRCm39) V283E probably damaging Het
Cep63 T C 9: 102,484,533 (GRCm39) I241V probably benign Het
Dis3 A G 14: 99,316,975 (GRCm39) V787A probably damaging Het
Eif5b G T 1: 38,057,131 (GRCm39) E63* probably null Het
Fanca A G 8: 124,023,078 (GRCm39) V553A probably damaging Het
Flacc1 C T 1: 58,717,504 (GRCm39) A136T probably benign Het
Gm37240 A C 3: 84,417,196 (GRCm39) H174Q probably benign Het
Kcnc4 C T 3: 107,365,571 (GRCm39) W212* probably null Het
Myh2 G A 11: 67,072,002 (GRCm39) E577K possibly damaging Het
Ncoa1 C T 12: 4,325,178 (GRCm39) V967I possibly damaging Het
Nmur2 T C 11: 55,931,649 (GRCm39) T21A probably damaging Het
Nrde2 A G 12: 100,110,426 (GRCm39) C197R probably damaging Het
Or2m12 A T 16: 19,104,943 (GRCm39) D183E probably benign Het
Or2o1 C A 11: 49,051,073 (GRCm39) C77* probably null Het
Or52ad1 T C 7: 102,995,569 (GRCm39) I189V probably benign Het
Or8h7 G T 2: 86,720,813 (GRCm39) H235Q probably benign Het
Pard3b C T 1: 62,250,786 (GRCm39) R572* probably null Het
Pdcd6ip T C 9: 113,520,589 (GRCm39) S132G probably damaging Het
Pdzrn3 A T 6: 101,149,235 (GRCm39) F364L probably benign Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Pgr G T 9: 8,901,532 (GRCm39) C355F possibly damaging Het
Pkhd1 T G 1: 20,188,004 (GRCm39) S3435R probably damaging Het
Pkhd1l1 A G 15: 44,410,284 (GRCm39) D2597G probably benign Het
Pramel30 T C 4: 144,057,095 (GRCm39) Y93H possibly damaging Het
Prrc2c T C 1: 162,508,359 (GRCm39) E2410G possibly damaging Het
Rpap2 C G 5: 107,768,180 (GRCm39) S339R probably benign Het
Rrp36 G C 17: 46,983,492 (GRCm39) R69G possibly damaging Het
Rrp8 T C 7: 105,382,606 (GRCm39) T449A probably benign Het
Scn3a T C 2: 65,366,860 (GRCm39) D54G probably damaging Het
Serinc2 C T 4: 130,152,516 (GRCm39) W228* probably null Het
Serpinb9g A G 13: 33,679,141 (GRCm39) K337R probably benign Het
Slc28a2b A T 2: 122,324,822 (GRCm39) K131N probably benign Het
Spata31 A T 13: 65,070,077 (GRCm39) I742F probably damaging Het
Speg C T 1: 75,399,426 (GRCm39) P2291L probably benign Het
Ss18l2 T A 9: 121,541,666 (GRCm39) L61* probably null Het
Suco C T 1: 161,661,668 (GRCm39) R921H probably damaging Het
Taok2 A T 7: 126,466,008 (GRCm39) I910N probably damaging Het
Tmem18 G A 12: 30,638,557 (GRCm39) M106I Het
Tob1 T G 11: 94,105,234 (GRCm39) S257A unknown Het
Trim67 G C 8: 125,521,497 (GRCm39) K286N possibly damaging Het
Trmt112 A G 19: 6,887,956 (GRCm39) N62S probably benign Het
Tsc2 C T 17: 24,819,308 (GRCm39) probably null Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ube2j1 G T 4: 33,040,793 (GRCm39) E100* probably null Het
Urgcp A T 11: 5,667,517 (GRCm39) F317I possibly damaging Het
Vps9d1 A T 8: 123,970,522 (GRCm39) D588E probably damaging Het
Wdr38 A T 2: 38,890,210 (GRCm39) T115S probably damaging Het
Zfp119a G A 17: 56,172,593 (GRCm39) Q417* probably null Het
Zfp687 C T 3: 94,916,442 (GRCm39) C860Y probably damaging Het
Zmym4 T C 4: 126,799,164 (GRCm39) N724S probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCACGCTTACCATAC -3'
(R):5'- TTTGAGACTCATCCTTGGACCTG -3'

Sequencing Primer
(F):5'- CTTCCCAAAAGGGTGGATATTAAGAC -3'
(R):5'- ATCCTTGGACCTGGTCACTATGG -3'
Posted On 2022-07-18