Incidental Mutation 'R9544:Mllt3'
ID 719987
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9544 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 87769925-88033364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87841181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 210 (D210V)
Ref Sequence ENSEMBL: ENSMUSP00000077232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000142454]
AlphaFold A2AM29
Predicted Effect probably damaging
Transcript: ENSMUST00000078090
AA Change: D210V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496
AA Change: D210V

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142454
SMART Domains Protein: ENSMUSP00000127376
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 26 66 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,239 E82G possibly damaging Het
Adra2a C G 19: 54,047,023 P270R probably benign Het
Alox12b A T 11: 69,163,986 I272F possibly damaging Het
Als2 C A 1: 59,211,309 E425D probably benign Het
Arhgap21 C A 2: 20,854,127 C1252F possibly damaging Het
Arhgap31 T G 16: 38,603,614 T697P probably damaging Het
Aspm C A 1: 139,457,785 T389K probably benign Het
B4galnt3 T A 6: 120,232,944 I73F probably damaging Het
Btn2a2 A G 13: 23,487,838 V27A probably benign Het
Cep97 A T 16: 55,914,940 N570K possibly damaging Het
Cfh T C 1: 140,108,528 I751V probably benign Het
Chd3 A G 11: 69,350,220 C1516R probably damaging Het
Cul3 A G 1: 80,280,859 F487L probably damaging Het
Dock1 T C 7: 134,746,457 S266P possibly damaging Het
Dock6 A T 9: 21,821,534 Y1118* probably null Het
Dolpp1 T A 2: 30,392,503 Y23N probably damaging Het
Egf T C 3: 129,717,968 M517V probably benign Het
Endou C A 15: 97,712,088 K442N probably damaging Het
Fam210b C T 2: 172,352,713 R162W probably damaging Het
Fbxw27 ATGT AT 9: 109,773,254 probably null Het
Flt3 T A 5: 147,354,632 Q641L possibly damaging Het
Ighv3-3 T A 12: 114,196,650 I47F probably damaging Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Kcnq2 T G 2: 181,087,614 D532A probably damaging Het
Krtap11-1 A C 16: 89,571,174 probably benign Het
Lamp3 T A 16: 19,676,082 probably null Het
Lcn3 A T 2: 25,766,139 I69L probably benign Het
Lrrc43 A T 5: 123,503,244 H497L probably damaging Het
Luc7l2 T G 6: 38,603,380 S305A unknown Het
Malrd1 C T 2: 15,635,998 T513I unknown Het
Mmp14 A G 14: 54,435,794 H53R possibly damaging Het
Ndst4 A C 3: 125,683,159 H11P probably damaging Het
Nln G A 13: 104,061,848 T152M probably benign Het
Oas1c A G 5: 120,808,137 F99L probably benign Het
Olfr1138 G A 2: 87,738,300 T8I probably benign Het
Olfr339 G T 2: 36,421,772 A125S probably damaging Het
Olfr395 T C 11: 73,906,811 K227R probably benign Het
Olfr843 T A 9: 19,249,265 I45F probably damaging Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pappa2 C A 1: 158,957,247 Q64H probably damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pcsk1 A T 13: 75,110,920 N271I probably damaging Het
Pkhd1l1 G A 15: 44,546,843 G2582D probably damaging Het
Psma4 A T 9: 54,954,961 Q123L probably damaging Het
Selenbp2 A T 3: 94,698,061 I127F possibly damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc29a3 G T 10: 60,716,181 C361* probably null Het
Slx4 C A 16: 3,980,053 R1489L probably damaging Het
Sorl1 A C 9: 42,081,809 Y306* probably null Het
Tbc1d16 G T 11: 119,210,509 H58Q probably damaging Het
Tfdp2 A G 9: 96,287,610 T5A probably damaging Het
Thbs1 G T 2: 118,123,451 G1061V probably damaging Het
Timm29 G A 9: 21,593,366 R110H probably damaging Het
Tmf1 C T 6: 97,170,332 E558K possibly damaging Het
Trappc11 T C 8: 47,519,678 T287A possibly damaging Het
Unc119b G A 5: 115,134,768 T48M probably benign Het
Vmn1r123 T C 7: 21,163,062 I293T probably benign Het
Vmn2r67 G A 7: 85,137,109 H563Y possibly damaging Het
Vps8 G T 16: 21,518,143 V763L probably benign Het
Wdr3 A T 3: 100,143,436 Y722* probably null Het
Xrn1 A G 9: 96,038,703 T1339A probably benign Het
Zfp827 T A 8: 79,178,975 H860Q probably damaging Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87774087 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 splice site probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R7380:Mllt3 UTSW 4 87791943 missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
R8871:Mllt3 UTSW 4 87841315 utr 3 prime probably benign
R9281:Mllt3 UTSW 4 87789329 missense probably benign 0.12
R9300:Mllt3 UTSW 4 87774047 nonsense probably null
R9341:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGGTGAGTAAGTTACTGTCTGC -3'
(R):5'- TTTCCAGGACCCTAACAGGAG -3'

Sequencing Primer
(F):5'- AAGTTACTGTCTGCTTTTGGCTC -3'
(R):5'- GGAGCATTCATACCAGCAGTAGC -3'
Posted On 2022-07-18