Incidental Mutation 'R9544:Mllt3'
ID 719987
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, 3830408D16Rik, 2210011H10Rik, D4Ertd321e, 2610012I03Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9544 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 87688162-87951601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87759418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 210 (D210V)
Ref Sequence ENSEMBL: ENSMUSP00000077232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000142454]
AlphaFold A2AM29
Predicted Effect probably damaging
Transcript: ENSMUST00000078090
AA Change: D210V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496
AA Change: D210V

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142454
SMART Domains Protein: ENSMUSP00000127376
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 26 66 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,271,202 (GRCm39) E82G possibly damaging Het
Adra2a C G 19: 54,035,454 (GRCm39) P270R probably benign Het
Alox12b A T 11: 69,054,812 (GRCm39) I272F possibly damaging Het
Als2 C A 1: 59,250,468 (GRCm39) E425D probably benign Het
Arhgap21 C A 2: 20,858,938 (GRCm39) C1252F possibly damaging Het
Arhgap31 T G 16: 38,423,976 (GRCm39) T697P probably damaging Het
Aspm C A 1: 139,385,523 (GRCm39) T389K probably benign Het
B4galnt3 T A 6: 120,209,905 (GRCm39) I73F probably damaging Het
Btn2a2 A G 13: 23,672,008 (GRCm39) V27A probably benign Het
Cep97 A T 16: 55,735,303 (GRCm39) N570K possibly damaging Het
Cfh T C 1: 140,036,266 (GRCm39) I751V probably benign Het
Chd3 A G 11: 69,241,046 (GRCm39) C1516R probably damaging Het
Cul3 A G 1: 80,258,576 (GRCm39) F487L probably damaging Het
Dock1 T C 7: 134,348,186 (GRCm39) S266P possibly damaging Het
Dock6 A T 9: 21,732,830 (GRCm39) Y1118* probably null Het
Dolpp1 T A 2: 30,282,515 (GRCm39) Y23N probably damaging Het
Egf T C 3: 129,511,617 (GRCm39) M517V probably benign Het
Endou C A 15: 97,609,969 (GRCm39) K442N probably damaging Het
Fam210b C T 2: 172,194,633 (GRCm39) R162W probably damaging Het
Fbxw27 ATGT AT 9: 109,602,322 (GRCm39) probably null Het
Flt3 T A 5: 147,291,442 (GRCm39) Q641L possibly damaging Het
Ighv3-3 T A 12: 114,160,270 (GRCm39) I47F probably damaging Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kcnq2 T G 2: 180,729,407 (GRCm39) D532A probably damaging Het
Krtap11-1 A C 16: 89,368,062 (GRCm39) probably benign Het
Lamp3 T A 16: 19,494,832 (GRCm39) probably null Het
Lcn3 A T 2: 25,656,151 (GRCm39) I69L probably benign Het
Lrrc43 A T 5: 123,641,307 (GRCm39) H497L probably damaging Het
Luc7l2 T G 6: 38,580,315 (GRCm39) S305A unknown Het
Malrd1 C T 2: 15,640,809 (GRCm39) T513I unknown Het
Mmp14 A G 14: 54,673,251 (GRCm39) H53R possibly damaging Het
Ndst4 A C 3: 125,476,808 (GRCm39) H11P probably damaging Het
Nln G A 13: 104,198,356 (GRCm39) T152M probably benign Het
Oas1c A G 5: 120,946,202 (GRCm39) F99L probably benign Het
Or10s1 T C 9: 39,986,353 (GRCm39) L254P probably damaging Het
Or1e35 T C 11: 73,797,637 (GRCm39) K227R probably benign Het
Or1j11 G T 2: 36,311,784 (GRCm39) A125S probably damaging Het
Or5w15 G A 2: 87,568,644 (GRCm39) T8I probably benign Het
Or7g25 T A 9: 19,160,561 (GRCm39) I45F probably damaging Het
Pappa2 C A 1: 158,784,817 (GRCm39) Q64H probably damaging Het
Pcdhb15 T C 18: 37,608,948 (GRCm39) F727L probably benign Het
Pcsk1 A T 13: 75,259,039 (GRCm39) N271I probably damaging Het
Pkhd1l1 G A 15: 44,410,239 (GRCm39) G2582D probably damaging Het
Psma4 A T 9: 54,862,245 (GRCm39) Q123L probably damaging Het
Selenbp2 A T 3: 94,605,368 (GRCm39) I127F possibly damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc29a3 G T 10: 60,551,960 (GRCm39) C361* probably null Het
Slx4 C A 16: 3,797,917 (GRCm39) R1489L probably damaging Het
Sorl1 A C 9: 41,993,105 (GRCm39) Y306* probably null Het
Tbc1d16 G T 11: 119,101,335 (GRCm39) H58Q probably damaging Het
Tfdp2 A G 9: 96,169,663 (GRCm39) T5A probably damaging Het
Thbs1 G T 2: 117,953,932 (GRCm39) G1061V probably damaging Het
Timm29 G A 9: 21,504,662 (GRCm39) R110H probably damaging Het
Tmf1 C T 6: 97,147,293 (GRCm39) E558K possibly damaging Het
Trappc11 T C 8: 47,972,713 (GRCm39) T287A possibly damaging Het
Unc119b G A 5: 115,272,827 (GRCm39) T48M probably benign Het
Vmn1r123 T C 7: 20,896,987 (GRCm39) I293T probably benign Het
Vmn2r67 G A 7: 84,786,317 (GRCm39) H563Y possibly damaging Het
Vps8 G T 16: 21,336,893 (GRCm39) V763L probably benign Het
Wdr3 A T 3: 100,050,752 (GRCm39) Y722* probably null Het
Xrn1 A G 9: 95,920,756 (GRCm39) T1339A probably benign Het
Zfp827 T A 8: 79,905,604 (GRCm39) H860Q probably damaging Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87,710,118 (GRCm39) missense probably benign 0.00
IGL01078:Mllt3 APN 4 87,798,297 (GRCm39) splice site probably benign
IGL01337:Mllt3 APN 4 87,759,057 (GRCm39) missense probably damaging 0.99
IGL02664:Mllt3 APN 4 87,949,860 (GRCm39) missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87,692,324 (GRCm39) missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87,758,969 (GRCm39) missense probably benign 0.00
R0415:Mllt3 UTSW 4 87,759,576 (GRCm39) utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87,759,281 (GRCm39) missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87,759,504 (GRCm39) utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87,707,621 (GRCm39) missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87,701,901 (GRCm39) missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87,759,018 (GRCm39) missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87,700,642 (GRCm39) splice site probably null
R5086:Mllt3 UTSW 4 87,707,535 (GRCm39) missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87,759,232 (GRCm39) missense probably benign 0.00
R5359:Mllt3 UTSW 4 87,759,164 (GRCm39) missense probably benign 0.21
R5371:Mllt3 UTSW 4 87,759,093 (GRCm39) missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87,759,448 (GRCm39) missense probably benign 0.01
R5787:Mllt3 UTSW 4 87,759,057 (GRCm39) missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87,759,445 (GRCm39) missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87,692,338 (GRCm39) missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87,759,034 (GRCm39) missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87,759,504 (GRCm39) utr 3 prime probably benign
R7380:Mllt3 UTSW 4 87,710,180 (GRCm39) missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87,759,456 (GRCm39) missense probably benign 0.07
R8045:Mllt3 UTSW 4 87,759,350 (GRCm39) missense probably damaging 1.00
R8871:Mllt3 UTSW 4 87,759,552 (GRCm39) utr 3 prime probably benign
R9281:Mllt3 UTSW 4 87,707,566 (GRCm39) missense probably benign 0.12
R9300:Mllt3 UTSW 4 87,692,284 (GRCm39) nonsense probably null
R9341:Mllt3 UTSW 4 87,792,168 (GRCm39) missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87,792,168 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGGTGAGTAAGTTACTGTCTGC -3'
(R):5'- TTTCCAGGACCCTAACAGGAG -3'

Sequencing Primer
(F):5'- AAGTTACTGTCTGCTTTTGGCTC -3'
(R):5'- GGAGCATTCATACCAGCAGTAGC -3'
Posted On 2022-07-18